US 7718629: "Compositions and methods for inhibiting expression of Eg5 gene"

The above example shows the number of issued patents in USPTO Class 360 by filing date. The year that US Patent 4131919: "Electronic still camera" was filed appears in orange. Learn more about Patent-In-Context

Patent Overview

Patent Title: Compositions and methods for inhibiting expression of Eg5 gene
Patent Number: 7718629 Filing Date: Mar 30, 2007
Application Number: 11694215 Issue Date: May 18, 2010
Back to Search Results


(click to expand)

1. A double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a human kinesin family member 11 (Eg5) gene in a cell, wherein said dsRNA comprises a sense strand comprising a first sequence and an antisense strand comprising a second sequence complementary to SEQ ID NO:1311, wherein said first sequence is complementary to said second sequence and wherein said dsRNA is between 15 and 30 base pairs in length.

2. The dsRNA of claim 1, wherein said dsRNA comprises at least one modified nucleotide.

3. The dsRNA of claim 2, wherein said modified nucleotide is chosen from the group of: a 2?-O-methyl modified nucleotide, a nucleotide comprising a 5?-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group.

4. The dsRNA of claim 2, wherein said modified nucleotide is chosen from the group of: a 2?-deoxy-2?-fluoro modified nucleotide, a 2?-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2?-amino-modified nucleotide, 2?-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.

5. An isolated cell comprising the dsRNA of claim 1.

6. A pharmaceutical composition for inhibiting the expression of the Eg5 gene comprising the dsRNA of claim 1.

7. The pharmaceutical composition of claim 6, further comprising a second dsRNA that inhibits the expression of the VEGF gene wherein the second dsRNA comprises a sense strand consisting of the sequence of SEQ ID NO:1242, and an antisense strand consisting of the sequence of SEQ ID NO:1243.

8. A method for inhibiting expression of a human kinesin family member 11 (Eg5) gene in a cell, the method comprising: (a) introducing into the cell the dsRNA of claim 1; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the Eg5 gene, thereby inhibiting expression of the Eg5 gene in the cell.

9. The method of claim 8, wherein a second dsRNA that inhibits the expression of VEGF is introduced into said cell wherein the second dsRNA comprises a sense strand consisting of the sequence of SEQ ID NO:1242, and an antisense strand consisting of the sequence of SEQ ID NO:1243.

10. A method of treating or managing pathological processes mediated by human kinesin family member 11 (Eg5) expression comprising administering to a patient in need of such treatment or management a therapeutically effective amount of the dsRNA of claim 1.

11. The method of claim 10 further comprising administering a second dsRNA that inhibits the expression of VEGF wherein the second dsRNA comprises a sense strand consisting of the sequence of SEQ ID NO:1242, and an antisense strand consisting of the sequence of SEQ ID NO:1243.

12. A vector for inhibiting the expression of a human kinesin family member 11 (Eg5) gene in a cell, said vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of a dsRNA, wherein one of the strands of said dsRNA is substantially complementary to SEQ ID NO:1311 and wherein said dsRNA is less than 30 base pairs in length.

13. An isolated cell comprising the vector of claim 12.

14. The dsRNA of claim 1, wherein said dsRNA, upon contact with a cell expressing said Eg5, inhibits expression of said Eg5 gene by at least 40%.

15. The dsRNA of claim 1, wherein said dsRNA is 19-21 base pairs in length.

16. The vector of claim 12, wherein said dsRNA, upon contact with a cell expressing said Eg5, inhibits expression of said Eg5 gene by at least 40%.

17. The vector of claim 12, wherein said dsRNA is 19-21 base pairs in length.

18. The pharmaceutical composition of claim 6, wherein the dsRNA is duplex AD12115 consisting of a sense strand consisting of SEQ ID NO:135 and an antisense strand consisting of SEQ ID NO:136.

19. The pharmaceutical composition of claim 7, wherein the dsRNA of claim 1 is duplex AD12115 consisting of a sense strand consisting of SEQ ID NO:135 and an antisense strand consisting of SEQ ID NO:136.

20. The method of claim 9, wherein said second dsRNA comprises a sense strand consisting of the sequence of SEQ ID NO:1242, and an antisense strand consisting of the sequence of SEQ ID NO:1243.

21. The dsRNA of claim 1, wherein the dsRNA is duplex AD12115 consisting of a sense strand consisting of SEQ ID NO:135 and an antisense strand consisting of SEQ ID NO:136.

22. The dsRNA of claim 21, wherein each strand is modified as follows to include a 2?-O-methyl ribonucleotide as indicated by a lower case letter ?c? or ?u? and a phosphorothioate as indicated by a lower case letter ?s?: SEQ ID NO:135 is ucGAGAAucuAAAcuAAcuTsT SEQ ID NO:136 is AGUuAGUUuAGAUUCUCGATsT.

23. A composition comprising the dsRNA of claim 1 and a second dsRNA that inhibits the expression of the VEGF gene, wherein the second dsRNA that inhibits the expression of VEGF comprises a sense strand consisting of the sequence of SEQ ID NO:1242, and an antisense strand consisting of the sequence of SEQ ID NO:1243.

24. The composition of claim 22, wherein the dsRNA of claim 1 is duplex AD12115 consisting of a sense strand consisting of SEQ ID NO:135 and an antisense strand consisting of SEQ ID NO:136.

25. The composition of claim 23, wherein the sense strand and antisense strand of the dsRNA of claim 1 are modified as follows to include a 2?-O-methyl ribonucleotide as indicated by a lower case letter ?c? or ?u? and a phosphorothioate as indicated by a lower case letter ?s?: SEQ ID NO:135 is ucGAGAAucuAAAcuAAcuTsT SEQ ID NO:136 is AGUuAGUUuAGAUUCUCGATsT.

26. The composition of claim 22 wherein the sense strand and antisense strand of the second dsRNA that inhibits the expression of VEGF are modified as follows to include a 2?-O-methyl ribonucleotide as indicated by a lower case letter ?c? or ?u? and a phosphorothioate as indicated by a lower case letter ?s?: GcAcAuAGGAGAGAuGAGCUsU (SEQ ID NO:1242) AAGCUcAUCUCUCCuAuGuGCusG (SEQ ID NO:1243).

27. The composition of claim 22, wherein the dsRNA of claim 1 is duplex AD12115 consisting of a sense strand consisting of SEQ ID NO:135 and an antisense strand consisting of SEQ ID NO:136 and the second dsRNA that inhibits the expression of VEGF comprises a sense strand consisting of the sequence of SEQ ID NO:1242 and an antisense strand consisting of the sequence of SEQ ID NO:1243.

28. The composition of claim 26, wherein the sense and antisense strands of the dsRNA of claim 1 and the sense strand and antisense strand of the second dsRNA that inhibits the expression of VEGF are modified as follows to include a 2?-O-methyl ribonucleotide as indicated by a lower case letter ?c? or ?u? and a phosphorothioate as indicated by a lower case letter ?s?: SEQ ID NO:135 is ucGAGAAucuAAAcuAAcuTsT SEQ ID NO:136 is AGUuAGUUuAGAUUCUCGATsT GcAcAuAGGAGAGAuGAGCUsU (SEQ ID NO:1242) AAGCUcAUCUCUCCuAuGuGCusG (SEQ ID NO:1243).

29. A pharmaceutical composition comprising the composition of claim 22.

30. At least one vector for inhibiting the expression of a human kinesin family member 11 (Eg5) gene and a VEGF gene in a cell, said vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of a first dsRNA and at least one strand of a second dsRNA, wherein one strand of said first dsRNA is substantially complementary to SEQ ID NO:1311 and one strand of said second dsRNA is substantially complementary to SEQ ID NO:1242 and wherein said first and second dsRNAs are less than 30 base pairs in length.

31. An isolated cell comprising the vector of claim 30.

32. The dsRNA of claim 2, comprising at least one 2?-O-Me ribonucleotide and at least one phosphorothioate.

33. The dsRNA of claim 22, comprising at least one 2?-O-Me ribonucleotide and at least one phosphorothioate.


(click to expand)

US ClassificationDescription
(+ truncated)
^----ORGANIC COMPOUNDS (Class 532, Subclass 1)
     ^----Carbohydrates or derivatives
          ^----Nitrogen containing
               ^----N-glycosides, polymers thereof, metal derivatives (e.g., nucleic acids, oligonucleotides, etc.)
                    ^----DNA or RNA fragments or modified forms thereof (e.g., genes, etc.)
^----ORGANIC COMPOUNDS (Class 532, Subclass 1)
     ^----Carbohydrates or derivatives
          ^----Nitrogen containing
               ^----N-glycosides, polymers thereof, metal derivatives (e.g., nucleic acids, oligonucleotides, etc.)
                    ^----DNA or RNA fragments or modified forms thereof (e.g., genes, etc.)
                         ^----Probes for detection of specific nucleotide sequences or primers for the synthesis of DNA or RNA
^----ORGANIC COMPOUNDS (Class 532, Subclass 1)
     ^----Carbohydrates or derivatives
          ^----Nitrogen containing
               ^----N-glycosides, polymers thereof, metal derivatives (e.g., nucleic acids, oligonucleotides, etc.)
                    ^----DNA or RNA fragments or modified forms thereof (e.g., genes, etc.)
                         ^----Probes for detection of specific nucleotide sequences or primers for the synthesis of DNA or RNA
^----ORGANIC COMPOUNDS (Class 532, Subclass 1)
     ^----Carbohydrates or derivatives
          ^----Nitrogen containing
               ^----N-glycosides, polymers thereof, metal derivatives (e.g., nucleic acids, oligonucleotides, etc.)
                    ^----DNA or RNA fragments or modified forms thereof (e.g., genes, etc.)
                         ^----Nucleic acid expression inhibitors


(click to expand)

Patent Number Author Title Cited by:
4426330 Sears Synthetic phospholipid compounds other
4534899 Sears Synthetic phospholipid compounds other
4837028 Allen Liposomes with enhanced circulation time other
4868116 Morgan et al. Introduction and expression of foreign genetic material in epithelial cells other
4980286 Morgan et al. In vivo introduction and expression of foreign genetic material in epithelial cells other
5013556 Woodle et al. Liposomes with enhanced circulation time other
5139941 Muzyczka et al. AAV transduction vectors other
5213804 Martin et al. Solid tumor treatment method and composition other
5225212 Martin et al. Microreservoir liposome composition and method other
5252479 Srivastava Safe vector for gene therapy other
5264221 Tagawa et al. Drug-containing protein-bonded liposome other
5328470 Nabel et al. Treatment of diseases by site-specific instillation of cells or site-specific transformation of cells and kits therefor other
5334711 Sproat et al. Synthetic catalytic oligonucleotide structures other
5356633 Woodle et al. Method of treatment of inflamed tissues other
5540935 Miyazaki et al. Reactive vesicle and functional substance-fixed vesicle other
5543152 Webb et al. Sphingosomes for enhanced drug delivery other
5556948 Tagawa et al. Phospholipid derivatized with PEG bifunctional linker and liposome containing it other
5595760 Cherif-Cheikh Sustained release of peptides from pharmaceutical compositions other
5627053 Usman et al. 2'deoxy-2'-alkylnucleotide containing nucleic acid other
5665710 Rahman et al. Method of making liposomal oligodeoxynucleotide compositions other
5672659 Shalaby et al. Ionic molecular conjugates of biodegradable polyesters and bioactive polypeptides other
5705188 Junichi et al. Drug composition containing nucleic acid copolymer other
5716824 Beigelman et al. 2'-O-alkylthioalkyl and 2-C-alkylthioalkyl-containing enzymatic nucleic acids (ribozymes) other
5854038 Sullenger et al. Localization of a therapeutic agent in a cell in vitro other
5902880 Thompson RNA polymerase III-based expression of therapeutic RNAs other
6054299 Conrad Stem-loop cloning vector and method other
6146886 Thompson RNA polymerase III-based expression of therapeutic RNAs other
6150092 Uchida et al. Antisense nucleic acid compound targeted to VEGF other
6395713 Beigelman et al. Compositions for the delivery of negatively charged molecules other
20030203844 Delfani et al. other
20040018176 Tolentino et al. other
20040180847 Dobie et al. other
20040209832 McSwiggen et al. other
20050255487 Khvorova et al. Methods and compositions for selecting siRNA of improved functionality other
20070031844 Khvorova et al. Functional and hyperfunctional siRNA other
DE 101 00 586 other
EP 0 445 131 other
EP 0 496 813 other
WO WO 88/04924 other
WO WO 89/02468 other
WO WO 89/05345 other
WO WO 89/07136 other
WO WO 90/04384 other
WO WO 91/05545 other
WO WO 92/07065 other
WO WO 92/07573 other
WO WO 93/15187 other
WO WO 93/23569 other
WO WO 93/24641 other
WO WO 94/02595 other
WO WO 94/13788 other
WO WO 94/20073 other
WO WO 96/10390 other
WO WO 96/10391 other
WO WO 96/10392 other
WO WO 96/40062 other
WO WO 97/04787 other
WO WO 97/13499 other
WO WO 97/026270 other
WO WO 97/30731 other
WO WO 98/13526 other
WO WO 99/32619 other
WO WO 99/53050 other
WO WO 99/61631 other
WO WO 00/22113 other
WO WO 00/22114 other
WO WO 00/44895 other
WO WO 00/53722 other
WO WO 03/070910 other
WO WO 2003/070918 other
WO WO 2004/001193 other
WO WO 2004/007070 other
WO WO 2004/011822 other
WO WO 2004/011829 other
WO WO 2004/064737 other
WO WO 2004/065601 other
WO WO 2004/080406 other
WO WO 2004/094345 other
WO WO 2004/094595 other
WO WO 2004/099410 other
WO WO 2005/014782 other
WO WO 2005/031002 other
WO WO 2007/115168 other

Referenced By:

(click to expand)

Patent Number Issue Date Title Author
8263572 Sep 11, 2012 RNAi modulation of RSV and therapeutic uses thereof Meyers, Rachel
8324368 Dec 04, 2012 GNAQ targeted dsRNA compositions and methods for inhibiting expression Gollob, Jared; Hinkle, Gregory; Toudjarska, Ivanka; Bumcrot, David
8153606 Apr 10, 2012 Treatment of apolipoprotein-A1 related diseases by inhibition of natural antisense transcript to apolipoprotein-A1 Collard, Joseph; Khorkova, Olga
8222222 Jul 17, 2012 Compositions and methods for inhibiting expression of the PCSK9 gene Tan, Pamela; Bramlage, Birgit; Frank-Kamenetsky, Maria; Fitzgerald, Kevin; Akinc, Akin; Kotelianski, Victor E.
8288354 Oct 16, 2012 Natural antisense and non-coding RNA transcripts as drug targets Wahlestedt, Claes
8158773 Apr 17, 2012 RNAi modulation of RSV and therapeutic uses thereof Myers, Rachel; Manoharan, Muthiah
8188061 May 29, 2012 RNAi modulation of APOB and uses thereof Soutschek, Juergen; Vornlocher, Hans-Peter; Hadwiger, Philipp; Elbashir, Sayda
8273869 Sep 25, 2012 Lipid formulated dsRNA targeting the PCSK9 gene Fitzgerald, Kevin; Hinkle, Gregory; Akinc, Akin; Milstein, Stuart
8288525 Oct 16, 2012 Compositions and methods for inhibiting expression of CD45 gene de Fougerolles, Antonin; Tan, Pamela; Borodovsky, Anna; Novobrantseva, Tatiana; Bavari, Sina; Warfield, Kelly Lyn
8268799 Sep 18, 2012 Compositions and methods for inhibiting expression of the HAMP gene Nakayama, Tomoko; Geick, Anke; Tan, Pamela; Lin, Herbert Y.
8293719 Oct 23, 2012 iRNA agents targeting VEGF De Fougerolles, Antonin; Frank-Kamenetsky, Maria; Manoharan, Muthiah; Rajeev, Kallanthottathil G.; Hadwiger, Philipp
8314075 Nov 20, 2012 Compositions and methods for inhibiting expression of huntingtin gene Sah, Dinah Wen-Yee; Hadwiger, Philipp; Roehl, Ingo; Bramlage, Birgit; Tan, Pamela; Vornlocher, Hans-Peter; Bumcrot, David


(click to expand)


This application claims the benefit of U.S. Provisional Application No. 60/787,762, filed Mar. 31, 2006, and U.S. Provisional Application No. 60/870,259, filed Dec. 15, 2006. Both prior applications are incorporated herein by reference in their entirety.


This invention relates to double-stranded ribonucleic acid (dsRNA), and its use in mediating RNA interference to inhibit the expression of the Eg5 gene and the use of the dsRNA to treat pathological processes mediated by Eg5 expression, such as cancer, alone or in combination with a dsRNA targeting vacular endothelian growth factor (VEGF).


The maintenance of cell populations within an organism is governed by the cellular processes of cell division and programmed cell death. Within normal cells, the cellular events associated with the initiation and completion of each process is highly regulated. In proliferative disease such as cancer, one or both of these processes may be perturbed. For example, a cancer cell may have lost its regulation (checkpoint control) of the cell division cycle through either the overexpression of a positive regulator or the loss of a negative regulator, perhaps by mutation.

Alternatively, a cancer cell may have lost the ability to undergo programmed cell death through the overexpression of a negative regulator. Hence, there is a need to develop new chemotherapeutic drugs that will restore the processes of checkpoint control and programmed cell death to cancerous cells.

One approach to the treatment of human cancers is to target a protein that is essential for cell cycle progression. In order for the cell cycle to proceed from one phase to the next, certain prerequisite events must be completed. There are checkpoints within the cell cycle that enforce the proper order of events and phases. One such checkpoint is the spindle checkpoint that occurs during the metaphase stage of mitosis. Small molecules that target proteins with essential functions in mitosis may initiate the spindle checkpoint to arrest cells in mitosis. Of the small molecules that arrest cells in mitosis, those which display anti-tumor activity in the clinic also include apoptosis, the morphological changes associated with programmed cell death. An effective chemotherapeutic for the treatment of cancer may thus be one which induces checkpoint control and programmed cell death. Unfortunately, there are few compounds available for controlling these processes within the cell. Most compounds known to cause mitotic arrest and apoptosis act as tubulin binding agents. These compounds alter the dynamic instability of microtubules and indirectly alter the function/structure of the mitotic spindle thereby causing mitotic arrest. Because most of these compounds specifically target the tubulin protein which is a component of all microtubules, they may also affect one or more of the numerous normal cellular processes in which microtubules, they may also affect one or more of the numerous normal cellular processes in which microtubules have a role. Hence, there is also a need for small molecules that more specifically target proteins associated with proliferating cells.

Eg5 is one of several kinesin-like motor proteins that are localized to the mitotic spindle and known to be required for formation and/or function of the bipolar mitotic spindle. Recently, there was a report of a small molecule that disturbs bipolarity of the mitotic spindle (Mayer, T. U. et. al. 1999. Science 286(5441) 971-4, herein incorporated by reference). More specifically, the small molecule induced the formation of an aberrant mitotic spindle wherein a monoastral array of microtubules emanated from a central pair of centrosomes, with chromosomes attached to the distal ends of the microtubules. The small molecule was dubbed ?monastrol? after the monoastral array. This monoastral array phenotype had been previously observed in mitotic cells that were immunodepleted of the Eg5 motor protein. This distinctive monoastral array phenotype facilitated identification of monastrol as a potential inhibitor of Eg5. Indeed, monastrol was further shown to inhibit the Eg5 motor-driven motility of microtubules in an in vitro assay. The Eg5 inhibitor monastrol had no apparent effect upon the related kinesin motor or upon the motor(s) responsible for golgi apparatus movement within the cell. Cells that display the monoastral array phenotype either through immunodepletion of Eg5 or monastrol inhibition of Eg5 arrest in M-phase of the cell cycle. However, the mitotic arrest induced by either immunodepletion or inhibition of Eg5 is transient (Kapoor, T. N., 2000, J Cell Biol 150(5) 975-80). Both the monoastral array phenotype and the cell cycle arrest in mitosis induced by monastrol are reversible. Cells recover to form a normal bipolar mitotic spindle, to complete mitosis and to proceed through the cell cycle and normal cell proliferation. These data suggest that a small molecule inhibitor of Eg5 which induced a transient mitotic arrest may not be effective for the treatment of cancer cell proliferation. Nonetheless, the discovery that monastrol causes mitotic arrest is intriguing and hence there is a need to further study and identify compounds which can be used to modulate the Eg5 motor protein in a manner that would be effective in the treatment of human cancers. There is also a need to explore the use of these compounds in combination with other antineoplastic agents.

VEGF (also known as vascular permeability factor, VPF) is a multifunctional cytokine that stimulates angiogenesis, epithelial cell proliferation, and endothelial cell survival. VEGF can be produced by a wide variety of tissues, and its overexpression or aberrant expression can result in a variety disorders, including cancers and retinal disorders such as age-related macular degeneration and other angiogenic disorders.

Recently, double-stranded RNA molecules (dsRNA) have been shown to block gene expression in a highly conserved regulatory mechanism known as RNA interference (RNAi)). WO 99/32619 (Fire et al.) discloses the use of a dsRNA of at least 25 nucleotides in length to inhibit the expression of genes in C. elegans. dsRNA has also been shown to degrade target RNA in other organisms, including plants (see, e.g., WO 99/53050, Waterhouse et al., and WO 99/61631, Heifetz et al.), Drosophila (see e.g., Yang, D., et al., Curr. Biol. (2000) 10:1191-1200), and mammals (see WO 00/44895, Limmer; and DE 101 00 586.5, Kreutzer et al.). This natural mechanism has now become the focus for the development of a new class of pharmaceutical agents for treating disorders that are caused by the aberrant or unwanted regulation of a gene.

Despite significant advances in the field of RNAi and advances in the treatment of pathological processes mediated by Eg5 expression, there remains a need for an agent that can selectively and efficiently silence the Eg5 gene using the cell's own RNAi machinery that has both high biological activity and in vivo stability, and that can effectively inhibit expression of a target Eg5 gene for use in treating pathological processes mediated by Eg5 expression.


The invention provides double-stranded ribonucleic acid (dsRNA), as well as compositions and methods for inhibiting the expression of the Eg5 gene in a cell or mammal using such dsRNA, alone or in combination with a dsRNA targeting VEGF. The invention also provides compositions and methods for treating pathological conditions and diseases caused by the expression of the Eg5 gene, such as in cancer. The dsRNA of the invention comprises an RNA strand (the antisense strand) having a region which is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and is substantially complementary to at least part of an mRNA transcript of the Eg5 gene.

In one embodiment, the invention provides double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of the Eg5 gene. The dsRNA comprises at least two sequences that are complementary to each other. The dsRNA comprises a sense strand comprising a first sequence and an antisense strand comprising a second sequence. The antisense strand comprises a nucleotide sequence which is substantially complementary to at least part of an mRNA encoding Eg5, and the region of complementarity is less than 30 nucleotides in length, generally 19-24 nucleotides in length. The dsRNA, upon contacting with a cell expressing the Eg5, inhibits the expression of the Eg5 gene by at least 40%.

For example, the dsRNA molecules of the invention can be comprised of a first sequence of the dsRNA that is selected from the group consisting of the sense sequences of Tables 1-3 and the second sequence is selected from the group consisting of the antisense sequences of Tables 1-3. The dsRNA molecules of the invention can be comprised of naturally occurring nucleotides or can be comprised of at least one modified nucleotide, such as a 2?-O-methyl modified nucleotide, a nucleotide comprising a 5?-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative. Alternatively, the modified nucleotide may be chosen from the group of: a 2?-deoxy-2?-fluoro modified nucleotide, a 2?-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2?-amino-modified nucleotide, 2?-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. Generally, such modified sequence will be based on a first sequence of said dsRNA selected from the group consisting of the sense sequences of Tables 1-3 and a second sequence selected from the group consisting of the antisense sequences of Tables 1-3.

In another embodiment, the invention provides a cell comprising one of the dsRNAs of the invention. The cell is generally a mammalian cell, such as a human cell.

In another embodiment, the invention provides a pharmaceutical composition for inhibiting the expression of the Eg5 gene in an organism, generally a human subject, comprising one or more of the dsRNA of the invention and a pharmaceutically acceptable carrier or delivery vehicle.

In another embodiment, the invention provides a method for inhibiting the expression of the Eg5 gene in a cell, comprising the following steps:

    • (a) introducing into the cell a double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises at least two sequences that are complementary to each other. The dsRNA comprises a sense strand comprising a first sequence and an antisense strand comprising a second sequence. The antisense strand comprises a region of complementarity which is substantially complementary to at least a part of a mRNA encoding Eg5, and wherein the region of complementarity is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and wherein the dsRNA, upon contact with a cell expressing the Eg5, inhibits expression of the Eg5 gene by at least 40%; and
    • (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the Eg5 gene, thereby inhibiting expression of the Eg5 gene in the cell.

In another embodiment, the invention provides methods for treating, preventing or managing pathological processes mediated by Eg5 expression, e.g. cancer, comprising administering to a patient in need of such treatment, prevention or management a therapeutically or prophylactically effective amount of one or more of the dsRNAs of the invention.

In another embodiment, the invention provides vectors for inhibiting the expression of the Eg5 gene in a cell, comprising a regulatory sequence operable linked to a nucleotide sequence that encodes at least one strand of one of the dsRNA of the invention.

In another embodiment, the invention provides a cell comprising a vector for inhibiting the expression of the Eg5 gene in a cell. The vector comprises a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of one of the dsRNA of the invention.

In a further embodiment, the invention provides the Eg5 dsRNA and the uses thereof as described above in combination with a second dsRNA targeting the VEGF mRNA. A combination of a dsRNA targeting Eg5 and a second dsRNA targeting VEGF provides complementary and synergiatic activity for treating hyperproliferative discords, particulary hepatic carcinoma.


No Figures are presented.


The invention provides double-stranded ribonucleic acid (dsRNA), as well as compositions and methods for inhibiting the expression of the Eg5 gene in a cell or mammal using the dsRNA. The invention also provides compositions and methods for treating pathological conditions and diseases in a mammal caused by the expression of the Eg5 gene using dsRNA. dsRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The invention further provides this dsRNA in combination with a second dsRNA that inhibits the expression of the VEGF gene.

The dsRNAs of the invention comprises an RNA strand (the antisense strand) having a region which is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and is substantially complementary to at least part of an mRNA transcript of the Eg5 gene. The use of these dsRNAs enables the targeted degradation of mRNAs of genes that are implicated in replication and or maintenance of cancer cells in mammals. Using cell-based and animal assays, the present invention have demonstrated that very low dosages of these dsRNA can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of the Eg5 gene. Thus, the methods and compositions of the invention comprising these dsRNAs are useful for treating pathological processes mediated by EG5 expression, e.g. cancer, by targeting a gene involved in mitotic division.

The following detailed description discloses how to make and use the dsRNA and compositions containing dsRNA to inhibit the expression of the Eg5 gene, as well as compositions and methods for treating diseases and disorders caused by the expression of Eg5, such as cancer, alone or in combination with a second dsRNA targeting the VEGF gene. The pharmaceutical compositions of the invention comprise a dsRNA having an antisense strand comprising a region of complementarity which is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and is substantially complementary to at least part of an RNA transcript of the Eg5 gene, together with a pharmaceutically acceptable carrier. As discussed above, such compositions can further include a second dsRNA targeting VEGF.

Accordingly, certain aspects of the invention provide pharmaceutical compositions comprising the dsRNA of the invention together with a pharmaceutically acceptable carrier, methods of using the compositions to inhibit expression of the Eg5 gene, and methods of using the pharmaceutical compositions to treat diseases caused by expression of the Eg5 gene. The invention further provides the above pharmaceutical compositions further containing a second dsRNA designed to inhibit the expression of VEGF.

I. Definitions

For convenience, the meaning of certain terms and phrases used in the specification, examples, and appended claims, are provided below. If there is an apparent discrepancy between the usage of a term in other parts of this specification and its definition provided in this section, the definition in this section shall prevail.

?G,? ?C,? ?A? and ?U? each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. However, it will be understood that the term ?ribonucleotide? or ?nucleotide? can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the invention.

As used herein, ?Eg5? refers to the human kinesine family member 11, which is also known in KIF11, Eg5, KNSL1 or TRIP5. Eg5 sequence can be found as NCBI GeneID:3832, HGNC ID: HGNC:6388 and RefSeq ID number NM?004523.

As used herein, ?target sequence? refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of the Eg5 gene, including mRNA that is a product of RNA processing of a primary transcription product.

As used hereing, VEGF, also known as vascular permeability factor, is an angiogenic growth factor. VEGF is a homodimeric 45 kDa glycoprotein that exists in at least three different isoforms. VEGF isoforms are expressed in endothelial cells. The VEGF gene contains 8 exons that express a 189-amino acid portein isoform. A 165-amino acid isoform lacks the residues encoded by exon 6, whereas a 121-amino acid isoform lacks the residues encoded by exons 6 and 7, VEGF145 is an isoform predicted to contain 145 amino acids and to lack exon 7. VEGF can act on endothelial cells by binding to an endothelial tyrosine kinase receptor, such as Flt-1 (VEGFR-1) or KDR/flk-1 (VEGFR-2). VEGFR-2 is expressed in endothelial cells and is involved in endothelial cell differentiation and vasculogenesis. A third receptor, VEGFR-3 has been implicated in lymphogenesis.

The various isoforms have different biologic activities and clinical implications. For example, VEGF145 includes angiogenesis and like VEGF189 (but unlike VEGF165) VEGF145 binds efficiently to the extracellular matrix by a mechanism that is not dependent on extracellular matrix-associated heparin sulfates. VEGF displays activity as an endothelial cell mitogen and chemoattractant in vitro and induces vascular permeability and angiogenesis in vivo. VEGF is secreted by a wide variety of cancer cell types and promotes the growth of tumors by inducing the development of tumor-associated vasculature. Inhibition of VEGF function has been shown to limit both the growth of primary experimental tumors as well as the incidence of metastases in immunocompromised mice. Various dsRNAs directed to VEGF are described in co-pending U.S. Ser. Nos. 11/078,073 and 11/340,080, herein incorporated by reference).

As used herein, the term ?strand comprising a sequence? refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

As used herein, and unless otherwise indicated, the term ?complementary,? when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. for 12-16 hours followed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

This includes base-pairing of the oligonucleotide or polynucleotide comprising the first nucleotide sequence to the oligonucleotide or polynucleotide comprising the second nucleotide sequence over the entire length of the first and second nucleotide sequence. Such sequences can be referred to as ?fully complementary? with respect to each other herein. However, where a first sequence is referred to as ?substantially complementary? with respect to a second sequence herein, the two-sequences can be fully complementary, or they may form one or more, but generally not more than 4, 3 or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their ultimate application. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as ?fully complementary? for the purposes of the invention.

?Complementary? sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled.

The terms ?complementary?, ?fully complementary? and ?substantially complementary? herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.

As used herein, a polynucleotide which is ?substantially complementary to at least part of? a messenger RNA (mRNA) refers to a polynucleotide which is substantially complementary to a contiguous portion of the mRNA of interest (e.g., encoding Eg5). For example, a polynucleotide is complementary to at least a part of a Eg5 mRNA if the sequence is substantially complementary to a non-interrupted portion of a mRNA encoding Eg5.

The term ?double-stranded RNA? or ?dsRNA?, as used herein, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary, as defined above, nucleic acid strands,. The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3?-end of one strand and the 5?end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a ?hairpin loop?. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3?-end of one strand and the 5?end of the respective other strand forming the duplex structure, the connecting structure is referred to as a ?linker?. The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, a dsRNA may comprise one or more nucleotide overhangs.

As used herein, a ?nucleotide overhang? refers to the unpaired nucleotide or nucleotides that protrude from the duplex structure of a dsRNA when a 3?-end of one strand of the dsRNA extends beyond the 5?-end of the other strand, or vice versa. ?Blunt? or ?blunt end? means that there are no unpaired nucleotides at that end of the dsRNA, i.e., no nucleotide overhang. A ?blunt ended? dsRNA is a dsRNA that is double-stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule.

The term ?antisense strand? refers to the strand of a dsRNA which includes a region that is substantially complementary to a target sequence. As used herein, the term ?region of complementarity? refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches are most tolerated in the terminal regions and, if present, are generally in a terminal region or regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5? and/or 3? terminus.

The term ?sense strand,? as used herein, refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.

?Introducing into a cell?, when referring to a dsRNA, means facilitating uptake or absorption into the cell, as in understood by those skilled in the art. Absorption or uptake of dsRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; a dsRNA may also be ?introduced into a cell?, wherein the cell is part of a living organism. In such instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, dsRNA can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection.

The terms ?silence? and ?inhibit the expression of?, in as far as they refer to the Eg5 gene, herein refer to the at least partial suppression of the expression of the Eg5 gene, as manifested by a reduction of the amount of mRNA transcribed from the Eg5 gene which may be isolated from a first cell or group of cells in which the Eg5 gene is transcribed and which has or have been treated such that the expression of the Eg5 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition is usually expressed in terms of

( mRNA ? ? in ? ? control ? ? cells ) - ( mRNA ? ? in ? ? treated ? ? cells ) ( mRNA ? ? in ? ? control ? ? cells ) · 100 ? %

Alternatively, the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to Eg5 gene transcription, e.g. the amount of protein encoded by the Eg5 gene which is secreted by a cell, or the number of cells displaying a certain phenotype, e.g. apoptosis. In principle, Eg5 gene silencing may be determined in any cell expressing the target, either constitutively or by genomic engineering, and by any appropriate assay. However, when a reference is needed in order to determine whether a given dsRNA inhibits the expression of the Eg5 gene by a certain degree and therefore is encompassed by the instant invention, the assay provided in the Examples below shall serve as such reference.

For example, in certain instances, expression of the Eg5 gene (or VEGF gene) is suppressed by at least about 20%, 25%, 35%, or 50% by administration of the double-stranded oligonucleotide of the invention. In some embodiment, the Eg5 gene is suppressed by at least about 60%, 70%, or 80% by administration of the double-stranded oligonucleotide of the invention. In some embodiments, the Eg5 gene is suppressed by at least about 85%, 90%, or 95% by administration of the double-stranded oligonucleotide of the invention. Tables 1-3 provides values for inhibition of expression using various Eg5 dsRNA molecules at various concentrations.

As used herein in the context of Eg5 expression, the terms ?treat?, ?treatment?, and the like, refer to relief from or alleviation of pathological processes mediated by Eg5 expression. In the context of the present invention insofar as it relates to any of the other conditions recited herein below (other than pathological processes mediated by Eg5 expression), the terms ?treat?, ?treatment?, and the like mean to relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression of such condition, such as the slowing and progression of hepatic carcinoma.

As used herein, the phrases ?therapeutically effective amount? and ?prophylactically effective amount? refer to an amount that provides a therapeutic benefit in the treatment, prevention, or management of pathological processes mediated by Eg5 expression or an overt symptom of pathological processes mediated by Eg5 expression (alone or in combination with VEGF expression). The specific amount that is therapeutically effective can be readily determined by ordinary medical practitioner, and may vary depending on factors known in the art, such as, e.g. the type of pathological processes mediated by Eg5 expression, the patient's history and age, the stage of pathological processes mediated by Eg5 expression, and the administration of other anti-pathological processes mediated by Eg5 expression agents.

As used herein, a ?pharmaceutical composition? comprises a pharmacologically effective amount of a dsRNA and a pharmaceutically acceptable carrier. As used herein, ?pharmacologically effective amount,? ?therapeutically effective amount? or simply ?effective amount? refers to that amount of an RNA effective to produce the intended pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 25% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 25% reduction in that parameter.

The term ?pharmaceutically acceptable carrier? refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract.

As used herein, a ?transformed cell? is a cell into which a vector has been introduced from which a dsRNA molecule may be expressed.

II. Double-stranded Ribonucleic Acid (dsRNA)

In one embodiment, the invention provides double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of the Eg5 gene (alone or incombination with a second dsRNA for inhibiting the expression of VEGF) in a cell or mammal, wherein the dsRNA comprises an antisense strand comprising a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of the Eg5 gene, and wherein the region of complementarity is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and wherein said dsRNA, upon contact with a cell expressing said Eg5 gene, inhibits the expression of said Eg5 gene by at least 40%. The dsRNA comprises two RNA strands that are sufficiently complementary to hybridize to form a duplex structure. One strand of the dsRNA (the antisense strand) comprises a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence, derived from the sequence of an mRNA formed during the expression of the Eg5 gene, the other strand (the sense strand) comprises a region which is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. Generally, the duplex structure us between 15 and 30, more generally between 18 and 25, yet more generally between 19 and 24, and most generally between 19 and 21 base pairs in length. Similarly, the region of complementarity to the target sequence is between 15 and 30, more generally between 18 and 25, yet more generally between 19 and 24, and most generally between 19 and 21 nucleotides in length. The dsRNA of the invention may further comprise one or more single-stranded nucleotide overhang(s). The dsRNA can be synthesized by stranded methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. In a preferred embodiment, the Eg5 gene is the human Eg5 gene. In specific embodiments, the antisense strand of the dsRNA comprises the sense sequences of Tables 1-3 and the second sequence is selected from the group consisting of the antisense sequences of Tables 1-3. Alternative antisense agents that target elsewhere in the target sequence provided in Tables 1-3 can readily be determined using the target sequence and the flanking Eg5 sequence. In embodiments using a second dsRNA targeting VEGF, such agents are exemplified in the Examples and in co-pending U.S. Ser. Nos. 11/078,073 and 11/340,080, herein incorporated by reference.

The dsRNA will comprise at least two nucleotide sequence selected from the groups of sequences provided in Tables 1-3. One of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of the Eg5 gene. As such, the dsRNA will comprises two oligonucleotides, wherein one oligonucleotide is described as the sense strand in Tables 1-3 and the second oligonucleotide is described as the antisense strand in Tables 1-3.

The skilled person is well aware that dsRNAs comprising a duplex structure of between 20 and 23, but specifically 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, others have found that shorter or longer dsRNAs can be effective as well. In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided in Tables 1-3, the dsRNAs of the invention can comprise at least one strand of a length of minimally 21 nt. It can be reasonably expected that shorter dsRNAs comprising one of the sequences of Tables 1-3 minus only a few nucleotides on one or both ends may be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs comprising a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one of the sequences of Tables 1-3, and differing in their ability to inhibit the expression of the Eg5 gene in a FACS assay as described herein below by not more than 5, 10, 15, 20, 25, or 30% inhibition from a dsRNA comprising the full sequence, are contemplated by the invention. Further dsRNAs that cleave within the target sequence provided in Tables 1-3 can readily be made using the Eg5 sequence and the target sequence provided.

In addition, the RNAi agents provided in Tables 1-3 identify a site in the Eg5 mRNA that is susceptible to RNAi based cleavage. As such the present invention further includes RNAi agents that target within the sequence targeted by one of the agents of the present invention. As used herein a second RNAi agent is said to target within the sequence of a first RNAi agent if the second RNAi agent cleaves the message anywhere within the mRNA that is complementary to the antisense strand of the first RNAi agent. Such a second agent will generally consist of at least 15 contiguous nucleotides from one of the sequences provided in Tables 1-3 coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in the Eg5 gene. For example, the last 15 nucleotides of SEQ ID NO:1 combined with the next 6 nucleotides from the target Eg5 gene produces a single strand agent of 21 nucleotides that is based on one of the sequences provided in Tables 1-3.

The dsRNA of the invention can contain one or more mismatches to the target sequence. In a preferred embodiment, the dsRNA of the invention contains no more than 3 mismatches. If the antisense strand of the dsRNA contains mismatches to a target sequence, it is preferable that the area of mismatch not be located in the center of the region of complementarity. If the antisense strand of the dsRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to 5 nucleotides from either end, for example 5, 4, 3, 2, or 1 nucleotide from either the 5? or 3? end of the region of complementarity. For example, for a 23 nucleotide dsRNA strand which is complementary to a region of the Eg5 gene, the dsRNA generally does not contain any mismatch within the central 13 nucleotides. The methods described within the invention can be used to determine whether a dsRNA containing a mismatch to a target sequence is effective in inhibiting the expression of the Eg5 gene. Consideration of the efficacy of dsRNAs with mismatches in inhibiting expression of the Eg5 gene is important, especially if the particular region of complementarity in the Eg5 gene is known to have polymorphic sequence variation within the population.

In one embodiment, at least one end of the dsRNA has a single-stranded nucleotide overhang of 1 to 4, generally 1 or 2 nucleotides. dsRNAs having at least one nucleotide overhang have unexpectedly superior inhibitory properties than their blunt-ended counterparts. Moreover, the present inventors have discovered that the presence of only one nucleotide overhang strengthens the interference activity of the dsRNA, without affecting its overall stability. dsRNA having only one overhang has proven particularly stable and effective in vivo, as well as in a variety of cells, cell culture mediums, blood, and serum. Generally, the single-stranded overhang is located at the 3?-terminal end of the antisense strand or, alternatively, at the 3?-terminal end of the sense strand. The dsRNA may also have a blunt end, generally located at the 5?-end of the antisense strand. Such dsRNAs have improved stability and inhibitory activity, thus allowing administration at low dosages, e.g., less than 5 mg/kg body weight of the recipient per day. Generally, the antisense strand of the dsRNA has a nucleotide overhang at the 3?-end, and the 5?-end is blunt. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

In yet another embodiment, the dsRNA is chemically modified to enhance stability. The nucleic acids of the invention may be synthesized and/or modified by methods well established in the art, such as those described in ?Current protocols in nucleic acid chemistry?, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Ind., New York, N.Y., USA, which is hereby incorporated herein by reference. Specific examples of preferred dsRNA compounds useful in this invention include dsRNAs containing modified backbones or no natural internucleoside linkages. As defined in this specification, dsRNAs having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified dsRNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.

Preferred modified dsRNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3?-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3?-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3?-5? linkages, 2?-5? linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3?-5? to 5?-3? or 2?-5? to 5?-2?. Various salts, mixed salts and free acid forms are also included.

Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which in herein incorporated by reference.

Preferred modified dsRNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloakyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or ore or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, each of which is herein incorporated by reference.

In other preferred dsRNA mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, and dsRNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an dsRNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262; each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

Most preferred embodiments of the invention are dsRNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular ?CH.sub.2-NH?CH.sub.2-, ?CH.sub.2-N(CH.sub.3)-O?CH.sub.2-[known as a methylene (methylimino) or MMI backbone], ?CH.sub.2-O?N(CH.sub.3)-CH.sub.2-, ?CH.sub.2-N(CH.sub.3)-N(CH.sub.3)?CH.sub.2- and -N(CH.sub.3)-CH.sub.2-CH.sub.2-[wherein the native phosphodiester backbone is represented as ?O?P?O?CH.sub.2-] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. Also preferred are dsRNAs having morepholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.

Modified dsRNAs may also contain one or more substituted sugar moieties. Preferred dsRNAs comprise one of the following at the 2? position: OH; F; O?, S?, or N-alkyl; O?, S?, or N-alkenyl; O?, S? or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Particularly preferred are O[(CH.sub.2).sub.nO].sub.mCH.sub.3, (CH.sub.2).ub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).xub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2)].sub.2, where n and m are from 1 to about 10. Other preferred dsRNAs comprise one of the following at the 2? position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an dsRNA, or a group for improving the pharmacodynamic properties of an dsRNA, and other substituents having similar properties. A preferred modification includes 2?-methoxyethoxy (2?-O?CH.sub.2CH.sub.2OCH.sub.3, also known as 2?-O-(2)methoxyethyl) or 2?-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkozy-alkoxy group. A further preferred modification includes 2?-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2?-DNAOE, as described in examples hereinbelow, and 2?-dimethylaminothoxyethoxy (also known in the art as 2?-O-dimethylaminoethoxyethyl or 2?-DMAEOE), i.e., 2?-O?CH.sub.2-O?CH.sub.2-N(CH.sub.2).sub.2, also described in examples hereinbelow.

Other preferred modifications include 2?-methoxy (2?-OCH.sub.3), 2?-aminopropoxy (2?-OCH.sub.2CH.sub2NH.sub.2) and 2?-fluoro (2?-F). Similar modifications may also be made at other positions on the dsRNA, particularly the 3? position of the sugar on the 3? terminal nulceotide or in 2?-5? linked dsRNAs and the 5? position of 5? terminal nucleotide. DsRNAs may also have sugar mimetics such as cyclobutul moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

DsRNAs may also include nucleobase (often referred to in the art simply as ?base?) modifications or substitutions. As used herein, ?unmodified? or ?natural? nucleobases include the puring bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouacil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and sytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenin. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons. 1990, these disclosed by Englisch et al., Angewandti Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, DsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynyleytosine, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., DsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2?-O-methoxyethyl sugar modifications.

Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, also herein incorporated by reference.

Another modification of the dsRNAs of the invention involves chemically linking to the dsRNA one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the dsRNA. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 199, 86, 6553-6556), cholic acid (Mancharan et al., Biorg. Med. Chem. Let., 1994 4 1053-1060), a thioether, e.g., beryl-S-triylthiol (Manoharan et al., Ann, N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimic, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-hlycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-Hphosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shen et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).

Representative U.S. patents that teach the preparation of such dsRNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538, 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 5,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,345,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241; 5,391,723; 5,416,203; 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference.

It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an dsRNA. The present invention also includes dsRNA compounds which are chimeric compounds. ?Chimeric? dsRNA compounds or ?chimeras,? in the context of this invention, are dsRNA compounds, particularly dsRNAs, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an dsRNA compound. These dsRNAs typically contain at least one region wherein the dsRNA is modified so as to confer upon the dsRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the dsRNA may serve as a substrate for anzymes capable of cleaving RNA-DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNAduplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of dsRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter dsRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxydsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

In certain instances, the dsRNA may be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to dsRNAs in order to enhance the activity, cellular distribution or cellular uptake of the dsRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad, Sci., 1992, 660-306; Manoharan et al., Bioorg. Med. Chem. Let. 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-hlycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shen et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim, Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacel. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such dsRNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of dsRNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the dsRNA still bound to the solid support or following cleavage of the dsRNA in solution phase. Purification of the dsRNA conjugate by HPLC typically affords the pure conjugate.

Vector Encoded RNAi Agents

The dsRNA of the invention can also be expressed from recombinant viral vectors intracellularly in vivo. The recombinant viral vectors of the invention comprise sequences encoding the dsRNA of the invention and any suitable promoter for expressing the dsRNA sequences. Suitable promoters include, for example, the U6 or H1 RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the dsRNA in a particular tissue or in a particular intracellular environment. The use of recombinant viral vectors to deliver dsRNA of the invention to cells in vivo is discussed in more detail below.

dsRNA of the invention can be expressed from a recombinent viral vector either as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.

Any viral vector capable of accepting the coding sequences for the dsRNA molecule(s) so be expressed can be used, for example vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); harpes virus, and the like. The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.

For example, lentiviral vectors of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokela, and the like. AAV vectors of the invention can be made to target different cells by engineering the vectors to express different capsid protein serotypes. For example, an AAV vector expressing a serotype 2 capsid on a serotype 2 genome is called AAV 2/2. This serotype 2 capsid gene in the AAV 2/2 vector can be replaced by a serotype 5 capsid gene to produce an AAV 2/5 vector. Techniques for constructing AAV vectors which express different capsid protein serotypes are within the skill in the art; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.

Selection of recombinant viral vectors suitable for use in the invention, methods for inserting nucleic acid sequences for expressing the dsRNA into the vector, and methods of delivering the viral vector to the cells of interest are within the skill in the art. See, for example, Dornburg R (1995), Gene Therap. 2: 301-310, Eglitis M A (1988), Biotechniques 6: 608-614; Miller A D (1990), Hum Gene Therap. 1: 5-14; Anderson W F (1998), Nature 392: 25-30; and Rubinson D A et al., Nat. Genet. 33: 401-406, the entire disclosures of which are herein incorporated by reference.

Preferred viral vectors are those derived from AV and AAV. In a particularly preferred embodiment, the dsRNA of the invention is expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector comprising, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter.

A suitable AV vector for expressing the dsRNA of the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.

Suitable AAV vectors for expressing the dsRNA of the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K. J et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.

III. Pharmaceutical Compositions Comprising dsRNA

In one embodiment, the invention provides pharmaceutical compositions comprising a dsRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical composition comprising the dsRNA is useful for treating a disease or disorder associated with the expression or activity of the Eg5 gene, such as pathological processes mediated by Eg5 expression. Such pharmaceutical composition are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery.

In another embodiment, such compositions will further comprise a second dsRNA that inhibits VEGF expression. dsRNA directed to VEGF are described in the Examples and in co-pending U.S. Ser. Nos. 11/078,073 and 11/340,080.

The pharmaceutical compositions of the invention are administered to dosages sufficient to inhibit expression of the Eg5 gene (and VEGF expression when a second dsRNA is included). In general, a suitable dose of dsRNA will be in the range of 0.01 to 5.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 microgram to 1 mg per kilogram body weight per day. The pharmaceutical composition may be administered once daily or the dsRNA may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the dsRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the dsRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual dsRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.

Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as pathological processes mediated by Eg5 expression. Such models are used for in vivo testing of dsRNA, as well as for determining a therapeutically effective dose.

The present invention also includes pharmaceutical compositions and formulations which include the dsRNA compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical, pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.

Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Preferred topical formulations include those in which the dsRNAs of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and sufactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). DsRNAs of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, dsRNAs may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters include but are not limited arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dieaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcamitine, an acylcholine, or a C1-10 alkyl ester (e.g. isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298 filed on May 20, 1999 which is incorporated herein by reference in its entirety.

Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which dsRNAs of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-digydro-fusidate and sodium glycodihydrofusidate. Preferred fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glycerly 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g. sodium). Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkyleyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polimines, pollulans, celluloses and starches. Particularly preferred complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyomithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g. p-amino), poly(methyleyanoacrylate), poly(ethylcyanoacrylate), poly(butylcayanoacrylate), poly(isobutylcyanoacrylate), poly(isohexyleynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. application Ser. No. 08/886,829 (filed Jul. 1, 1997), Ser. No. 09/108,673 (filed Jul. 1, 1998), Ser No. 09/256,515 (filed Feb. 23, 1999), Ser. No. 09/082,624 (filed May 21, 1998) and Ser. No. 09/315,298 (filed May 20, 1999), each of which is incorporated herein by reference in their entirety.

Compositions and formulations for parenteral, intrathecal, intraventricular or intrahepatic administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Particularly preferred are formulations that target the liver when treating hepatic disorders such as hepatic carcinoma.

The pharmaceutical formulations of the present invention, which may conventeitly be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and the, if necessary, shaping the product.

The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.


The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding in diameter (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Bander (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volumn 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Leiberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, INc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Leiberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general emulsions may be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marchel Dekker, Inc., New York, N.Y., volume 1, p. 199).

Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volumn 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their sermisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

A large variety of non-emulsifying materials are also included in eulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Bander (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the ixternal phase.

Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quatemary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent detreioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

In one embodiment of the present invention, the compositions of dsRNAs and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active moleculses (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyehtylene oleyl ethers, plyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The sosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipis based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailibility of drugs, including peptides (Constrantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solic dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al.,Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, piptides or dsRNAs. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of dsRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of dsRNAs and nucleic acids.

Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the dsRNAs and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories?surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.


There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term ?liposome? means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.

Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.

In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.

Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes and as the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.

Lipsomal formulations have been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.

Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis.

Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

Liposomes which are pH-sensitive or negatively-charged , entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type of formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g. as a solution or as an emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).

Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome.TM.I (glyceryl dilaurate/cholesterol/po-lyoxyethylene-10-stearyl ether) and Novasome.TM.II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4, 6, 466).

Liposomes also include ?sterically stabilized? liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

Various liposomes comprising one or more glycolipids are known in the art. Papagadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside G.sub.M1, galactocerebrodside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949), U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphat-idylcholine are disclosed in WO 97/13499 (Lim et al).

Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic couting of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophsica Acta, 1990, 1029, 91) extended such observations to other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG.Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and European Patent No. EP 0 496 813 B1). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al). U.S. Pat. No. 5,540,935 (Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces.

A limited number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an dsRNA RNA. U.S. Pat. No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising dsRNA dsRNAs targeted to the raf gene.

Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the ?head?) provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y. 1988, p. 285).

If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

If the surfactant molecule carries a negative charge when it is disolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sufates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

If the surfactant molecule carries a positve charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

Penetration Enhancers

In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly dsRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

Surfactants: In connection with the present invention, surfactants (or ?surface-active agents?) are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of dsRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluouochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

Fatty acids: Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (N-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylearnitines, acylcholines, C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carryier Systems, 1991, p. 92; Muranishi, Critical Reviews in Terapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

Bile salts: The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term ?bile salts? includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxyeholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chanodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 79, 579-583).

Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of dsRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

Non-chelating non-surfactants: As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of dsRNAs through the alimentary mucose (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers include, for example unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacycle-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

Agents that enhance uptake of dsRNAs at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example cationic lipids, such as lipodectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic hlycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs.

Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.


Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, ?carrier compound? or ?carrier? can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulate, polyytidic acid or 4-acetamido-4?isothiocyano-stilbene-2,2?-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.


In contrast to a carrier compound, a ?pharmaceutical carrier? or ?excipient? is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solic and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., When combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, tale, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).

Pharmaceutically acceptable organic or inorganic excipient suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

Formulations for toptical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

Other Components

The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipurities, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, decarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphor-amide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al., eds., Rahway, N.J. When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively). Other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.

Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the Ed50 (the dose therapeutically effective in 50% of the population). The dose ration between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit high therapeutic indices are preferred.

The data obtained from cell culture assays and animal studies can be used in formulation a range of dosage for use in humans. The dosage of compositions of the invention lies generally within a range of circulating concentrations that include the Ed50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

In addition to their administration individually or as a plurality, as discussed above, the dsRNAs of the invention can be administered in combination with other known agents effective in treatment of pathological processes mediated by Eg5 expression. In any event, the administering physician can adjust the amount and timing of dsRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.

Methods for Treating Diseases Caused by Expression of the Eg5 Gene

The invention relates in particular to the use of a dsRNA or a pharmaceutical composition prepared thereform for the treatment of cancer, e.g., for inhibiting tumor growth and tumor metastasis. For example, the dsRNA or a pharmaceutical composition prepared therefrom may be used for the treatment of solid tumors, like breast cancer, lung cancer, head and neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophagus cancer, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma and for the treatment of skin cancer, like melanoma, for the treatment of lymphormas and blood cancer. The invention further relates to the use of an dsRNA according to the invention or a pharmaceutical composition prepared therefrom for inhibiting eg5 expression and/or for inhibiting accumulation of ascites fluid and plural effusion in different types of cancer, e.g., breast cancer, lung cancer, head cancer, neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophagus cancer, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma, skin cancer, melanoma, lymphomas and blood cancer. Owing to the inhibitory effect on eg5 expression, an dsRNA according to the invention or a pharmaceutical composition prepared thereform can enhance the quality of life.

The invention futhermore relates to the use of an dsRNA or a pharmaceutical composition thereof, e.g., for treating cancer or for preventing tumor metastasis, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating cancer and/or for preventing tumor metastasis. Preference is given to a combination with radiation therapy and chemotherapeutic agents, such as cisplatin, cyclophosphamide, 5-fluoroacil, adriamycin, daunorabicin or tamoxifen. Other embodiments include the use of a second dsRNA used to inhibit the expression of VEGF.

The invention can also be practiced by including with a specific RNAi agent, in combination with another anti-cancer chemotherapeutic agent, such as any conventional chemotherapeutic: agent, or another dsRNA used to inhibit the expression of VEGF. The combination of a specific binding agent with such other agents can potentiate the chemotherapeutic protocol. Numerous chemotherapeutic protocols will present themselves in the mind of the skilled practitioner as being capable of incorporation into the method of the invention. Any chemotherapeutic agent can be used, including alkylating agents, antimetabolites, hormones and antagonists, radioisotopes, as well as natural products. For example, the compound of the invention can be administered with antibiotics such as doxorubicin and other anthracycline analogs, nitrogen mustards such as cyclophosphamide, pyrimidine analogs such as 5-fluorouracil, cisplatin, hydroxyurea, traxol and its natural and synthetic derivatives, and the like. As another example, in the case of mixed tumors, such as adenocarcinoma of the breast, where the tumors include gonadotropin-dependent and gonadotropin-independent cells, the compound can be administered in conjunction with leuprolide or goserelin (synthetic peptide analogs of LH-RH). Other antineoplastic protocols include the use of a tetracycline compound with another treatment modality, e.g.,surgery, radiation, etc., also referred to herein as ?adjunct antineoplastic modalities.? Thus, the method of the invention can be employed with such conventional regimens with the benefit of reducing side effects and enhancing efficacy.

Methods for Inhibiting Expression of the Eg5 Gene

In yet another aspect, the invention provides a method for inhibiting the expression of the Eg5 gene in a mammal. The method comprises administering a composition of the invention to the mammal such that expression of the target Eg5 gene is silenced. Because of their high specificity, the dsRNAs of the invention specifically target RNAs (primary or processed) of the target Eg5 gene. Compositions and methods for inhibiting the expression of these Eg5 genes using dsRNAs can be performed as described elsewhere herein.

In one embodiment, the method comprises administering a composition comprising a dsRNA, wherein the dsRNA comprises a nucleotide sequence which is complementary to at least a part of an RNA transcript of the Eg5 gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the compositions may be administered by any means known in the art including, but not limited to oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In preferred embodiments, the compositions are administered by intravenous infusion or injection.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, suitable methods and materials are described below. All publications patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.


Gene Walking of the Eg5 Gene

Initial Screening Set

siRNA design was carried out to identify siRNAs targeting Eg5 (also known as KIF11, HSKP, KNSL1 and TRIP5). Human mRNA sequences to Eg5, RefSeq ID number:NM?004523, was used.

siRNA duplexes cross-reactive to human and mouse Eg5 were designed. Twenty-four duplexes were synthesized for screening. (Table 1).

Expanded Screening Set

A second screening set was defined with 266 siRNAs targeting human EG5, as well as its rhesus monkey ortholog (Table 2). An expanded screening set was selected with 328 siRNA targeting human EG5, with no necessity to hit any EG5 mRNA of other species (Table 3).

The sequences for human and a partial rhesus EG5 mRNAs were downloaded from NCBI Nucleotide database and the human sequence was further on used as reference sequence (Human EG5:NM?004523.2, 4908 bp, and Rhesus EG5: XM?001087644.1, 878 bp (only 5? part of human EG5).

For identification of further rhesus EG5 sequences a mega blast search with the human sequence was conducted at NCBI against rhesus reference genome. The downloaded rhesus sequence and the hit regions in the blast hit were assembled to a rhesus consensus sequence with ?92% identity to human EG5 over the full-length.

All possible 19 mers were extracted from the human mRNA sequence, resulting in the pool of candidate target sites corresponding to 4890 (sense strand) sequences of human-reactive EG5 siRNAs.

Human-rhesus cross-reactivity as prerequisite for in silico selection of siRNAs for an initial screening set out of this candidate pool. To determine rhesus-reactive siRNAs, each candidate siRNA target site was searched for presence in the assembled rhesus sequence. Further, the predicted specificity of the siRNA as criterion for selection of out the pool of human-rhesus cross-reactive siRNAs, manifested by targeting human EG5 mRNA sequences, but not other human mRNAs.

The specificity of an siRNA can be expressed via its potential to target other genes, which are referred to as ?off-target genes?.

For predicting the off-target potential of an siRNA, the following assumptions were made:

    • 1) off-target potential of a strand can be deduced from the number and distribution of mismatches to an off-target
    • 2) the most relevant off-target, that is the gene predicted to have the highest probability to be silenced due to tolerance of mismatches, determines the off-target potential of the strand
    • 3) positions 2 to 9 (counting 5? to 3?) of a strand (seed region) may contribute more to off-target potential than rest of sequence (that is non-seed and cleavage site region)
    • 4) positions 10 and 11 (counting 5? to 3?) of a strand (cleavage site region) may contribute more to off-target potential than non-seed region (that is positions 12 to 18, counting 5? to 3?)
    • 5) position 1 and 19 of each strand are not relevant for off-target interactions
    • 6) off-target potential can be expressed by the off-target score of the most relevant off-target, calculated based on number and position of mismatches of the strand to the most homologous region in the off-target gene considering assumptions 3 to 5
    • 7) off-target potential of antisense and sense strand will be relevant, whereas potential abortion of sense strand activity by internal modifications introduced is likely

SiRNAs with low off-target potential were defined as preferable and assumed to be more specific.

In order to identify human EG5-specific siRNAs, all other human transcripts, which were all considered potential off-targets, were searched for potential target regions for human-rhesus cross-reactive 19 mer sense strand sequences as well as complementary antisense strands. For this, the fastA algorithm was used to determine the most homologues hit region in each sequence of the human RefSeq database, which we assume to represent the comprehensive human transcriptome.

To rank all potential off-targets according to assumptions 3 to 5, and by this identify the most relevant off-target gene and its off-target score, fastA output files were analyzed further by a perl script.

The script extracted the following off-target properties for each 19 mer input sequence and each off-target gene to calculate the off-target score:

Number of mismatches in non-seed region

Number of mismatches in seed region

Number of mismatches in cleavage site region

The off-target score was calculated by considering assumptions 3 to 5 as follows:

Off ? - ? target ? ? score = number ? ? of ? ? seed ? ? mismatches * 10 + number ? ? of ? ? cleavage ? ? site ? ? mismatches * 1.2 + number ? ? of ? ? non ? - ? seed ? ? mismatches * 1

The most relevant off-target gene for each 19 mer sequence was defined as the gene with the lowest off-target score. Accordingly, the lowest off-target score was defined as representative for the off-target potential of a strand.

For the screening set in Table 2, an off-target score of 3 or more for the antisense strand and 2 or more for the sense strand was chosen as prerequisite for selection of siRNAs, whereas all sequences containing 4 or more consecutive G's (poly-G sequences) were excluded. 266 human-rhesus cross-reactive sequences passing the specificity criterion, were selected based on this cut-off (see Table 2).

For definition of the expended screening set the cross-reactivity to rhesus was disgarded, re-calculated the predicted specificity based on the newly available human RefSeq database and selected only those 328 non-poly-G siRNAs with off-target score of 2,2 or more for the antisense and sense strand (see Table 3).

For the Tables: Key: A,G,C,U-ribonucleotides: T-deoxythymidine: u,c-2?-O-mehtyl nucleotides: s-phosphorothioate linkage

dsRNA Synthesis

Source of Reagents

Where the source of a reagent is not specifically given herein, such reagent may be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.

siRNA Synthesis

Single-stranded RNAs were produced by solid phase synthesis on a scale of 1 ?mole using an Expedite 8909 synthesizer (Applied Biosystems, Applera Deutschland GmbH, Darmstadt, Germany) and controlled pore glass (CPG, 500 ?, Proligo Biochemie GmbH, Hamburg, Germany) as solid support. RNA and RNA containing 2?-O-methyl nucleotides were generated by solid phase synthesis employing the corresponding phosphoramidites and 2?-O-methyl phosphoramidites, respectively (Proligo Biochemic GmbH, Hamburg, Germany). These building blocks were incorporated at selected sites within the sequence of the oligoribonucleotide chain using standard nucleoside phosphoramidite chemistry such as descried in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Ind., New York, N.Y., USA. Phosphorothioate linkages were introduced by replacement of the iodine oxidizer solution with a solution of the Beaucage reagent (Chruachem Ltd, Glasgow, UK) in acetonitrile (1%). Further ancillary reagents were obtained from Mallinckrodt Baker (Griesheim, Germany).

Deprotection and purification of the crude oligoribonucleotides by anion exchange HPLC were carried out according to established procedures. Yields and concentrations were determined by UV absorption of a solution of the respective RNA at a wavelength of 260 nm using a spectral photometer (DU 640B, Beckman Coulter GmbH, Unterschlei?heim, Germany). Double stranded RNA was generated by mixing an equimolar solution of complementary strands in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride), beated in a water bath at 85-90° C. for 3 minutes and cooled to room temperature over a period of 3-4 hours. The annealed RNA solution was stored at ?20° C. until use.

For the synthesis of 3?-cholesterol-conjugated siRNAs (herein referred to as -Chol-3?), an appropriately modified solid support was used for RNA synthesis. The modified solid support was prepared as follows:

Diethyl-2-azabutane-1,4-dicarboxylate AA

A 4.7 M aqueous solution of sodium hydroxide (50 mL) was added into a stirred, ice-cooled solution of ehtyl glycinate hydrochloride (32.19 g, 0.23 mole) in water (50 mL). Then, ethyl acrylate (23.1 g, 0.23 mole) was added and the mixture was stirred at room temperature until completion of the reaction was ascertained by TLC. After 19 h the solution was partitioned with dichloromethane (3×100 mL). The organic layer was dried with anhydrous sodium sulfate, filtered and evaporated. The residue was distilled to afford AA (28.8 g, 61%).

3-{Ethoxycarbonylmethyl-[6-(9H-fluoren-9-ylmethoxycarbonyl-amino)-hexanoyl]-amino}-propionic acid ethyl ester AB

Fmoc-6-amino-hexanoic acid (9.12 g, 25.83 mmol) was dissolved in dichloromethane (50 mL) and cooled with ice. Diisopropylcarbodiimde (3.25 g, 3.99 mL, 25.83 mmol) was added to the solution at 0° C. It was then followed by the addition of Diethyl-azabutane-1,4-dicarboxylate (5 g, 24.6 mmol) and dimethylamino pyridine (0.305 g, 2.5 mmol). The solution was brought to room temperature and stirred further for 6 h. Completion of the reaction was ascertained by TLC. The reaction mixture was concentrated under vacuum and ethyl acetate was added to precipitate diisopropyl area. The suspension was filtered. The filtrate was washed with 5% aqueous hydrochloric acid, 5% sodium bicarbonate and water. The combined organic layer was dried over sodium sulfate and concentrated to give the crude product which was purified by column chromatography (50% EtOAC/Hexanes) to yield 11.87 g (88%) of AB.

3-[(6-Amino-hexanoyl)-ethoxycarbonylmethyl-amino]-propionic acid ethyl ester AC

3-{Ethoxycarbonylmethyl-[6-(9H-fluoren-9-ylmethoxycarbonylamino)-hexanoyl]-amino}-propionic acid ethyl ester AB (11.5 g, 21.3 mmol) was dissolved in 20% piperidine in dimethylformamide at 0° C. The solution was continued stirring for 1 h. The reaction mixture was concentrated under vacuum, water was added to the residue, and the product was extracted with ethyl acetate. The crude product was purified by conversion into its hydrochloride salt.

3-({6-[17-1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxycarbonylamino]-hexanoyl} ethoxycarbonylmethyl-amino)-propionic acid ethyl ester AD

The hydrdochloride salt of 3-[(6-Amino-hexanoyl)-ethoxycarbonylmethyl-amino]-propionic acid ethyl ester AC(4.7 g, 14.8 mmol) was taken up in dichloromethane. The suspension was cooled to 0° C. on ice. To the suspension diisopropylethylamine (3.87 g, 5.2 mL, 30 mmol) was added. To the resulting solution cholesteryl chloroformate (6.675 g, 14.8 mmol) was added. The reaction mixture was stirred overnight. The reaction mixture was diluted with dichloromethane and washed with 10% hydrochloric acid. The product was purified by flash chromatography (10.3 g, 92%).

1-{6-[17-(1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopents[a] phenanthren-3-yloxycarbonylamino]-hexanoyl}-4-oxo-pyrrolidine-3-carboxylic acid ethyl ester AE

Potassium t-butoxide (1.1 g, 9.8 mmol) was slurried in 30 mL of dry toluene. The mixture was cooed to 0° C. on ice and 5 g (6.6 mmol) of diester AD was added slowly with stirring within 20 mins. The temperature was kept below 5° C. during the addition. The stirring was continued for 30 mins at 0° C. and 1 mL of glacial acetic acid was added, immediately followed by 4 g of NaH2PO4.H2O in 40 mL of water. The resultant mixture was extracted twice with 100 mL of dichloromethane each and the combined organic extracts were washed twice with 10 mL of phosphate buffer each, dried, and evaporated to dryness. The residue was dissolved in 60 mL of toluene, cooled to 0° C. and extracted with three 50 mL portions of cold pH 9.5 carbonate buffer. The aqueous extracts were adjusted to pH 3 with phosphoric acid, and extracted with five 40 mL portions of chloroform which were combined, dried and evaporated to dryness. The residue was purified by column chromatography using 25% ethylacetate/hexane to afford 1.9 g of b-detoester (39%).

[6-(3-Hydroxy-4-hydroxymethyl-pyrrolidin-1-yl)-6-oxo-hexyl]-carbamic acid 17-(1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl ester AF

Methanol (2.) was added dropwise over a period of 1 h to a refluxing mixture of b-ketoester AE (1.5 g, 2.2 mmol) and sodium borohydride (0.226 g, 6 mmol) in tetrahydrofuran (10 mL). Stirring was continued at reflux temperature for 1 h. After cooling to room temperature, 1 N NCl (12.5 mL) was added, the mixture was extracted with ethylacetate (3×40 mL). The combined ethylacetate layer was dried over anhydrous sodium sulfate and concentrated under vacuum to yield the product which was purified by column chromatography (10% MeOH/CHCl3) (89%).

(6-{3-[Bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-pyrrolidin-1-yl}-6-oxo-hexyl)-carbamic acid 17-(1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl ester AG

Diol AF (1.25 g, 1.994 mmol) was dried by evaporating with pyridine (2×5 mL) in vacuo. Anhydrous pyridine (10 mL) and 4,4?-dimethoxytritylchloride (0.724 g, 2.13 mmol) were added with stirring. The reaction was carried out at room temperature overnight. The reaction was quenched by the addition of methanol. The reaction mixture was concentrated under vacuum and to the residue dichloromethane (50 mL) was added. The organic layer was washed with 1 M aqueous sodium bicarbonate. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The residual pyridine was removed by evaporating with toluene. The crude product was purified by column chromatography (2% MeOH/Chloroform, Rf=0.5 in 5% MeOH/CHCl3) (1.75 g, 95%).

Succinic acid mono-(4-[bos-(4-methoxy-phenyl-methoxymethyl]-1-{6-[17-(1,5-dimethyl-hexyl)-10,13-dimethyl 2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H cyclopenta[a]phenanthren-3-yloxycarbonylamino]-hexanoyl}-pyrrolidin-3-yl) ester AH

Compound AG (1.0 g, 1.05 mmol) was mixed with succinic anhydride (0.150 g, 1.5 mmol) and DMAP (0.073 g, 0.6 mmol) and dried in a vacuum at 40° C. overnight. The mixture was dissolved in anhydrous dichloroethane (3 mL), triethylamine (0.318 g, 0.0440 mL, 3.15 mmol) was added and the solution was stirred at room temperature under argon atmosphere for 16 h. It was then diluted with dichloromethane (40 mL) and washed with ice cold aqueous citric acid (5 wt %, 30 mL) and water (2×20 mL). The organic phase was dried over anhydrous sodium sulfate and concentrated to dryness. The residue was used as such for the next step.

Cholesterol Derivatised CPG AI

Succinate AH (0.254 g, 0.242 mmol) was dissolved in a mixture of dichloromethane/acetonitrile (3:2, 3 mL). To that solution DMAP (0.0296 g, 0.242 mmol) in acetonitrile (1.25 mL), 2,2?-Dithio-bis(5-nitropyridine) (0.075 g, 0.242 mmol) in acetonitrile/dichloroethane (3:1, 1.25 mL) were added successively. To the resulting solution triphenylphosphine (0.064 g, 0.242 mmol) in acetonitrile (0.6 ml) was added. The reaction mixture turned bright orange in color. The solution was agitated briefly using a wrist-action shaker (5 mins). Long chain alkyl amine-CPG (LCAA-CPG) (1.5 g, 61 mM) was added. The suspension was agitated for 2 h. The CPG was filtered through a sintered funnel and washed with acetonitrile, dichloromethane and ether successively. Unreacted amino groups were masked using acetic anhydride/hyridine. The achieved loading of the CPG was measured by taking UV measurement (37 mM/g).

The synthesis of siRNAs bearing a 5?-12-dodecanoic acid bisdecylamide group (herein referred to as ?5?-C32-?) or a 5?-cholesteryl derivative group (herein referred to as ?5?-Chol-?) was performed as described in WO 2004/065601, except that, for the cholesteryl derivative, the oxidation step was performed using the Beaucage reagent in order to introduce a phosphorothioate linkage at the 5?-end of the nucleic acid oligomer.

Nucleic acid sequences are represented below using standard nomenclature, and specifically the abbreviations of Table 4.

TABLE 4 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5?-3?-phosphodiester bonds. Abbreviation3 Nucleotide (s) A, a 2?-deoxy-adenosine-5?-phosphate, adenosine-5?- phosphate C, c 2?-deoxy-cytidine-5?-phosphate, cytidine-5?- phosphate G, g 2?-deoxy-guanosino-5?-phosphate, guanosine-5?- phosphate T, t 2?-deoxy-thymidine-5?-phosphate, thymidine-5?- phosphate U, u 2?-deoxy-uridine-5?-phosphate, uridine-5?-phosphate N, n any 2?-deoxy-nucleotide/nucleotide (G, A, C, or T, g, a, c or u) Am 2?-O-methyladenosine-5?-phosphate Cm 2?-O-methylcytidine phosphate Gm 2?-O-methylguanosine-5?-phosphate Tm 2?-O-methyl-thymidine-5?-phosphate Um 2?-O-methyluridine-5?-phosphate Af 2?-fluoro-2?-deoxy-adenosine-5?-phosphate Cf 2?-fluoro-2?-deoxy-cytidine-5?-phosphate Gf 2?-fluoro-2?-deoxy-guanosine-5?-phosphate Tf 2?-fluoro-2?-deoxy-thymidine-5?-phosphate Uf 2?-fluoro-2?-deoxy-uridine-5?-phosphate A, C, G, T, U, underlined: nucleoside-5?-phosphorothioate a, c, g, t, u am, cm, gm, tm, underlined: 2-O-methyl-nucleoside-5?-phosphorothioate um 3capital letters represent 2?-deoxribonucletides (DNA), lower case letters represent ribonucleotides (RNA)

dsRNA Expression Vectors

In another aspect of the invention , Eg5 specific dsRNA molecules that modulate Eg5 gene expression activity are expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., EIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publicatoin No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be incorporated and inherited as a transgene integrated into the host genome. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

The individual strands of a dsRNA can be transcribed by promoters on two separate expression vectors and co-transfected into a target cell. Alternatively each individual strand of the dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In preferred embodiment, a dsRNA is expressed as an inverted repeat joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.

The recombination dsRNA expression vectors are generally DNA plasmids or viral vectors. dsRNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus (for a review, see Muzyezka, et al., Curr. Topics Micro. Immunol. (1992) 158:97-129)); adenovirus (see, for example, Berkner, et al., BioTechniques (1998) 6:616), Rosenfeld et al. (1991, Science 252:431-434), and Rosenfeld et al. (1992), Cell 68:143-155)); or alphavirus as well as others known in the art. Retroviruses have been used to introduce a viariety of genes into many different cell types, including epithelial cells, in vitro and/or in vivo and/or in vivo (see, e.g., Eglitis, et al., Science (1985) 230:1395-1398; Danos and Mulligan, Proc. Natl. Acad. Sci. USA (1998) 85:6460-6464; Wilson et al., 1988, Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al., 1990, Proc. NatI. Acad. Sci. USA 87:61416145; Huber et al., 1991, Proc. NatI. Acad. Sci. USA 88:8039-8043; Ferry et al., 1991, Proc. NatI. Acad. Sci. USA 88:8377-8381; Chowdhury et al., 1991, Science 354:1802-1805; van Beusechem. et al., 1992, Proc. Nad. Acad. Sci. USA 89:7640-19; Kay et al., 1992, Human Gene Therapy 3:641-647; Dai et al., 1992, Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al., 1993, J. Ummunol. 150:4104-4115; U.S. Pat. No. 4,868,116; U.S. Pat. No. 4,980,286; PCT Application WO 89/07136; PCT Application WO 89/02468; PCT Application WO 89/05344; and PCT Application WO 92/07573). Recombinant retroviral vectors capable of transducing and expressing genes inserted into the genome of a cell can be produced by transfecting the recombinant retroviral genome into suitable packaging cell lines such as PA317 and Psi-CRIP (Comette et al., 1991, Human Gene Therapy 2:5-10; Cone et al., 1984, Proc. Natl. Acad. Sci. USA 81:6349). Recombinant adenoviral vectors can be used to infect a wide variety of cells and tissues in susceptible hosts (e.g., rat, hamster, dog, and chimpanzee) (Hsu et al., 1992, J. Invectious Disease, 166:769), and also have the advantage of not requiring mitotically active cells for infection.

The promoter driving dsRNA expression in either a DNA plasmid or viral vector of the invention may be a eukaryotic RNA polymerase I (e.g. ribosomal RNA promoter), RNA polymerase II (e.g. CNV early promoter or actin promoter or U1 snRNA promoter) or generally RNA polymerase III prometer (e.g. U6 snRNA or 7SK RNA promoter) or a prokaryotic promoter, for example the T7 promoter, provided the expression plasmid also encodes T7 RNA polymerase required for transcription from a T7 Promoter. The promoter can also direct transgene expression to the pancreas (see, e.g. the insulin regulatory sequence for pancreas (Bucchini et al., 1986, Proc, Natl. Acad. Sci. USA 83:2511-2515)).

In addition, expression of the transgene can be precisely regulated, for example, by using an inducible regulatory sequence and expression systems such as a regulatory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Docherty et al., 1994, FASWV J. 8:20-24). Such inducible expression systems, suitable for the control of transgene expression in cells or in mammals include regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dierization, and isopropyl-beta-D1-thiogalactopyranoside (EPTG). A person skilled in the art would be able to choose the appropriate regulatory/promoter sequence based on the intended use of the dsRNA transgene.

Generally, recombinant vectors capable of expressing dsRNA molecules are delivered as described below, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of dsRNA molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the dsRNAs bind to target RNA and modulate its function or expression. Delivery of dsRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.

dsRNA expression DNA plasmids are typically transfected into target cells as a complex with cationic lipid carriers (e.g., Oligofectamine) or non-cationic lipid-based carriers (e.g. Transit-TKO?). Multiple lipid transfections for dsRNA-mediated knockdowns targeting different regions of a single Eg5 gene or multiple Eg5 genes over a period of a week or more are also contemplated by the invention. Successful introduction of the vectors of the invention into host cells can be monitored using various known methods. For example, transient transfection, can be signaled with a reporter, such as a flourescent marker, such as Green Fluorescent Protein (GFP). Stable transfection of ex vivo cells can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.

The Eg5 dsRNA molecules can also be inserted into vectors and sued as gene therapy vectors for human patients. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see e.g., Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91:3045-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

Eg5 siRNA in vitro Screening via Cell Proliferation

As silencing of Eg5 has been shown to cause mitotic arrest (Weil, D, et al [2002] Biotechniques 33: 1244-8), a cell viability assay was used for siRNA activity screening. HeLa cells (14000 per well [Screens 1 and 3] or 10000 per well [Screen2])) were seeded in 96-well plates and simultaneously transfected with Lipofectamine 2000 (Invitrogen) at a final siRNA concentration in the well of 30 nM and at final concentrations of 50 nM (1st screen) and 25 nM (2nd screen). A subset of duplexes was tested at 25 nM in a third screen (Table 5).

Seventy-two hours post-transfection, cell proliferation was assayed the addition of WST-1 reagent (Roche) to the culture medium, and subsequent absorbance measurement at 450 nm. The absorbance value for control (non-transfected) cells was considered 100 percent, and absorbances for the siRNA transfected wells were compared to the control value. Assays were performed in sextuplicate for each of three screens. A subset of the siRNAs was further tested at a range of siRNA concentrations. Assays were performed in HeLa cells (14000 per well; method same as above, Table 5).

TABLE 5 Relative absorbance at 450 nm Screen I Screen II Screen III Duplex mean sd Mean sd mean Sd AL-DP-6226 20 10 28 11 43 9 AL-DP-6227 66 27 96 41 108 33 AL-DP-6228 56 28 76 22 78 18 AL-DP-6229 17 3 31 9 48 13 AL-DP-6230 48 8 75 11 73 7 AL-DP-6231 8 1 21 4 41 10 AL-DP-6232 16 2 37 7 52 14 AL-DP-6233 31 9 37 6 49 12 AL-DP-6234 103 40 141 29 164 45 AL-DP-6235 107 34 140 27 195 75 AL-DP-6236 48 12 54 12 56 12 AL-DP-6237 73 14 108 18 154 37 AL-DP-6238 64 9 103 10 105 24 AL-DP-6239 9 1 20 4 31 11 AL-DP-6240 99 7 139 16 194 43 AL-DP-6241 43 9 54 12 66 19 AL-DP-6242 6 1 15 7 36 8 AL-DP-6243 7 2 19 5 33 13 AL-DP-6244 7 2 19 3 37 13 AL-DP-6245 25 4 45 10 58 9 AL-DP-6246 34 8 65 10 66 13 AL-DP-6247 53 6 78 14 105 20 AL-DP-6248 7 0 22 7 39 12 AL-DP-6249 36 8 48 13 61 7

The nine siRNA duplexes that showed the greatest growth inhibition in Table 5 were re-tested at a range of siRNA concentrations in HeLa cells. The siRNA concentrations tested were 100 nM, 33.3 nM, 11.1 nM, 3.70 nM, 1.23 nM, 0.41 nM and 0.046 nM. Assays were performed in sextuplicate, and the concentration of each siRNA resulting in fifty percent inhibition of cell proliferation (IC50) was calculated. This dose-response analysis was performed between two and four times for each duplex. Mean IC50 values (nM) are given in Table 6.

TABLE 6 Duplex Mean IC50 AL-DP-6226 15.5 AL-DP-6229 3.4 AL-DP-6231 4.2 AL-DP-6232 17.5 AL-DP-6239 4.4 AL-DP-6242 5.2 AL-DP-6243 2.6 AL-DP-6244 8.3 AL-DP-6248 1.9

Eg5 siRNA in vitro Screening via Cell Proliferation

Directly before transfection, Hela S3 (ATCC-Number: CCL-2:2, LCG Promochem GmbH, Wesel, Germany) cells were seeded at 1.5×104 cells/well on 96-well plates (Greiner Bio-One GmbH, Frickenhausen, Germany) in 75 ?l of growth medium (Ham's F12, 10% fetal calf serum, 100 u penicillin/100 ?g/ml streptomycin, all from Biochrom AG, Berlin, Germany). Transfections were performed in quadruplicates. For each well 0.5 ?l Lipofectamine2000 (Invitrogen GmbH, Darlsruhe, Germany) were mixed with 12 ?l Opti-MEM (Invitrogen) and incubated for 15 min at room temperature. For the siRNA concentration being 50 nM in the 100 ?l transfection volume, 1 ?l of a 5 ?M siRNA were mixed with 11.5 ?l Opti-MEM per well, combined with the Lipofectamine2000-Opti-MEM mixture and again incubated for 15 minutes at room temperature, siRNA-Lipofectamine2000-complexes were applied completely (25 ?l each per well) to the cells and cells were incubated for 24 h at 37° C. and 5% CO2 in a humidified incubator (Heracus GmbH, Hanau). The single dose screen was done once at 50 nM and at 25 nM, respectively.

Cells were harvested by applying 50 ?l of lysis mixture (content of the QuantiGene bDNA-kit from Genospectra, Fremont, USA) to each well containing 100 ?l of growth medium and were lysed at 53° C. for 30 min. Afterwards, 50 ?l of the lysates were incubated with probesets specific to human Eg5 and human GAPDH and proceeded according to the manufacturer's protocol for QuantiGene. In the end chemoluminescence was measured in a Victor2-Light (Perkin Elmer, Wiesbaden, Germany) as RLUs (relative light units) and values obtained with the hEg5 probeset were normalized to the respective GAPDH values for each well. Values obtained with siRNAs directed against Eg5 were related to the value obtained with an unspecific siRNA (directed against HCV) which was set to 100% (Tables 1, 2, and 3).

Effective siRNAs from the screen were further characterized by dose response curves. Transfections of dose response curves were performed at the following concentrations: 100 nM, 16.7 nM, 2.8 nM, 0.46 nM, 77 picoM, 12.8 picoM, 2.1 picoM, 0.35 picoM, 59.5 fM, 9.9 fM and mock (no siRNA) and diluted with Opti-MEM to a final concentration of 12.5 ?l according to the above protocol. Data analysis was performed by using the Microsoft Excel add-in software XL-fit 4.2 (IDBS, Guildford, Surrey, UK) and applying the dose response model number 205 (Tables 1, 2 and 3).

The lead siRNA AD12115 was additionally analyzed by applying the WST-proliferation assay from Roche (as previously described).

A subset of 34 duplexes from Table 2 that showed greatest activity was assayed by transfection in HeLa cells at final concentrations ranging from 100 nM to 10 fM. Transfections were performed in quadruplicate. Two dose-response assays were performed for each duplex. The concentration giving 20% (IC20), 50% (IC50) and 80% (IC80) reduction of KSP mRNA was calculated for each duplex. (Table 7).

TABLE 7 Concentrations given in pM IC20s IC50s IC80s Duplex name 1st screen 2nd screen 1st screen 2nd screen 1st screen 2nd screen AD12077 1.19 0.80 6.14 10.16 38.36 76.16 AD12078 25.43 25.43 156.18 156.18 ND ND AD12085 9.08 1.24 40.57 8.52 257.68 81.26 AD12095 1.03 0.97 9.84 4.94 90.31 60.47 AD12113 4.00 5.94 17.18 28.14 490.83 441.30 AD12115 0.60 0.41 3.79 3.39 23.45 23.45 AD12125 31.21 22.02 184.28 166.15 896.85 1008.11 AD12134 2.59 5.51 17.87 22.00 116.36 107.03 AD12149 0.72 0.50 4.51 3.91 30.29 40.89 AD12151 0.53 6.84 4.27 10.72 22.88 43.01 AD12152 155.45 7.56 867.36 66.69 13165.27 ND AD12157 0.30 26.23 14.60 92.08 14399.22 693.31 AD12166 0.20 0.93 3.71 3.86 46.28 20.59 AD12180 28.85 28.85 101.06 101.06 847.21 847.21 AD12185 2.60 0.42 15.55 13.91 109.80 120.63 AD12194 2.08 1.11 5.37 5.09 53.03 30.92 AD12211 5.27 4.52 11.73 18.93 26.74 191.07 AD12257 4.56 5.20 21.68 22.75 124.69 135.82 AD12280 2.37 4.53 6.89 20.23 64.80 104.82 AD12281 8.81 8.65 19.68 42.89 119.01 356.08 AD12282 7.71 456.42 20.09 558.00 ND ND AD12285 ND 1.28 57.30 7.31 261.79 42.53 AD12292 40.23 12.00 929.11 109.10 ND ND AD12252 0.02 18.63 6.35 68.24 138.09 404.91 AD12275 25.76 25.04 123.89 133.10 1054.54 776.25 AD12266 4.85 7.80 10.00 32.94 41.67 162.65 AD12267 1.39 1.21 12.00 4.67 283.03 51.12 AD12264 0.92 2.07 8.56 15.12 56.36 196.78 AD12268 2.29 3.67 22.16 25.64 258.27 150.84 AD12279 1.11 28.54 23.19 96.87 327.28 607.27 AD12256 7.20 33.52 46.49 138.04 775.54 1076.76 AD12259 2.16 8.31 8.96 40.12 50.05 219.42 AD12276 19.49 6.14 89.60 59.60 672.51 736.72 AD12321 4.67 4.91 24.88 19.43 139.50 89.49 ND-not determined

Silencing of Liver Eg5/KSP in Juvenile Rats Following Single-bolus Administration of LNP01 Formulated siRNA

From birth until approximately 23 days of age, Eg5/KSP expression can be detected in the growing rat liver. Target silencing with a formulated Eg5/KSP siRNA was evaluated in juvenile rats.

KSP Duplex Tested

Duplex ID Target Sense Antisense AD6248 Eg5 AccGAAGuGuuGuuuGuccTsT GGAcAAAcAAcACUUCGGUTsT (SEQ ID NO:1238) (SEQ ID NO:1239)


Dosing of animals. Male, juvenile Sprague-Dawley rats (19 days old) were administered single doses of lipidoid (?LNP01?) formulated siRNA via tail vein injection. Groups of ten animals received doses of 10 milligrams per kilogram (mg/kg) bodyweight of either AD6248 or an unspecific siRNA. Dose level refers to the amount of siRNA duplex administered in the formulation. A third group received phosphate-buffered saline. Animals were sacrificed two days after siRNA administration. Livers were dissected, flash frozen in liquid Nitrogen and pulverized into powders.

mRNA measurements. Levels of Eg5/KSP mRNA were measured in livers from all treatment groups. Samples of each liver powder (approximately ten milligrams) were homogenized in tissue lysis buffer containing proteinase K. Levels of Eg5/KSP and GAPDH mRNA were measured in triplicate for each sample using the Quantigene branched DNA assay (GenoSpectra). Mean values for Eg5/KSP were normalized to mean GAPDH values for each sample. Group means were determined and normalized to the PBS group for each experiment.

Statistical analysis. Significance was determined by ANOVA followed by the Tukey post-hoc test


Data Summary

Mean values (±standard deviation) for Eg5/KSP mRNA are given. Statistical significance (p value) versus the PBS group is shown (ns, not significant [p>0.05]).

Experiment 1

VEGF/GAPDH p value PBS ?1.0 ± 0.47 AD6248 10 mg/kg 0.47 ± 0.12 <0.001 unspec 10 mg/kg ?1.0 ± 0.26 ns

A statistically significant reduction in liver Eg5/KSP mRNA was obtained following treatment with formulated AD6248 at a dose of 10 mg/kg.

Silencing of Rat Liver VEGF Following Intravenous Infusion of LNP01 Formulated siRNA Duplexes

A ?lipidoid? formulation comprising an equimolar mixture of two siRNAs was administered to rats. One siRNA (AD3133) was directed towards VEGF. The other (AD12115) was directed towards Eg5/KSP. Since Eg5/KSP expression is nearly undetectable in the adult rat liver, only VEGF levels were measured following siRNA treatment.

siRNA Duplexes Administered

Duplex ID Target Sense Antisense AD12115 Eg5/KSP ucGAGAAucuAAAcuAAcuTsT AGUuAGUUuAGAUUCUCGATsT (SEQ ID NO:1240) (SEQ ID NO:1241) AD3133 VEGF GcAcAuAGGAGAGAuGAGCUsU AAGCUcAUCUCUCCuAuGuG (SEQ ID NO:1242) CusG (SEQ ID NO:1243) Key: A, G, C, U - ribonucleotides; c, u - 2?-O-Me ribonucleotides; s-phosphorothioate.


Dosing of animals. Adult, female Sprague-Dawley rats were administered lipidoid (?LNP01?) formulated siRNA by a two-hour infusion into the femoral vein. Groups of four animals received doses of 5, 10 and 15 milligrams per kilogram (mg/kg) bodyweight of formulated siRNA. Dose level refers to the total amount of siRNA duplex administered in the formulation. A fourth group received phosphate-buffered saline. Animals were sacrificed 72 hours after the end of the siRNA infusion. Livers were dissected, flash frozen in liquid Nitrogen and pulverized into powders.

Formulation Procedure

The lipidoid ND98-4HCl (MW 1487) (Formula 1), Cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) were used to prepare lipid-siRNA nanoparticles. Stock solutions of each in ethanol were prepared: ND98, 133 mg/mL; Cholesterol, 25 mg/mL, PEG-Ceramide C16, 100 mg/mL. ND98, Cholesterol, and PEG-Ceramide C16 stock solutions were then combined in a 42:48:10 molar ratio. Combined lipid solution was mixed rapidly with aqueous siRNA (in sodium acetate pH 5) such that the final ethanol concentration was 35-45% and the final sodium acetate concentration was 100-300 mM. Lipid-siRNA nanoparticles formed spontaneously upon mixing. Depending on the desired particle size distribution, the resultant nanoparticle mixture was in some cases extruded through a polycarbonate membrane (100 nm cut-off) using a thermobarrel extruder (Lipex Extruder, Northern Lipids, Inc). In other cases, the extrusion step was omitted. Ethanol removal and simultaneous buffer exchange was accomplished by either dialysis or tangential flow filtration. Buffer was exchanged to phosphate buffered saline (PBS) pH 7.2.

Characterization of Formulations

Formulations prepared by either the standard or extrusion-free method are characterized in a similar manner. Formulations are first characterized by visual inspection. They should be whitish translucent solutions free from aggregates or sediment. Particle size and particle size distribution of lipid-nanoparticles are measured by dynamic light scattering using a Malvern Zetasizer Nano ZS (Malvern, USA). Particles should be 20-300 nm, and ideally, 40-100 nm in size. The particle size distribution should be unimodal. The total siRNA concentration in the formulation, as well as the entrapped fraction, is estimated using a dye exclusion assay. A sample of the formulated siRNA is incubated with the RNA-binding dye Ribogreen (Molecular Probes) in the presence or absence of a formulation disrupting surfactant, 0.5% Triton-X100. The total siRNA in the formulation is determined by the signal from the sample containing the surfactant, relative to a standard curve. The entrapped fraction is determined by subtracting the ?free? siRNA content (as measured by the signal in the absence of surfactant) from the total siRNA content. Percent entrapped siRNA is typically >85%.

mRNA measurements. Samples of each liver powder (approximately ten milligrams) were homogenized in tissue lysis buffer containing proteinase K. Levels of VEGF and GAPDH mRNA were measured in triplicate for each sample using the Quantigene branched DNA assay (GenoSpectra). Mean values for VEGF were normalized to mean GAPDH values for each sample. Group means were determined and normalized to the PBS group for each experiment.

Protein measurements. Samples of each liver powder (approximately 60 milligrams) were homogenized in 1 ml RIPA buffer. Total protein concentrations were determined using the MicroBCA protein assay kit (Pierce). Samples of total protein from each animal was used to determine VEGF protein levels using a VEGF ELISA assay (R&D systems). Group means were determined and normalized to the PBS group for each experiment.

Statistical analysis. Significance was determined by ANOVA followed by the Tukey post-hoc test


Data Summary

Mean values (±standard deviation) for mRNA (VEGF/GAPDH) and protein (rel. VEGF) are shown for each treatment group. Statistical significance (p value) versus the PBS group for each experiment is shown.

VEGF/GAPDH p value rel VEGF p value PBS ?1.0 ± 0.17 ?1.0 ± 0.17 ?5 mg/kg 0.74 ± 0.12 <0.05 0.23 ± 0.03 <0.001 10 mg/kg 0.65 ± 0.12 <0.005 0.22 ± 0.03 <0.001 15 mg/kg 0.49 ± 0.17 <0.001 0.20 ± 0.04 <0.001

Statistically significant reductions in liver VEGF mRNA and protein were measured at all three siRNA dose levels.

TABLE 1 sequence of total position 23 mer in human target access. # site SEQ I sense sequence (5?-3?) 385-407 ACCGAAGUGUUGUUUGUCCAAUU 1 cGAAGuGuuGuuuGuccAATsT 347-369 UAUGGUGUUUGGAGCAUCUACUA 3 uGGuGuuuGGAGcAucuAcTsT 1078-1100 AAUCUAAACUAACUAGAAUCCUC 5 ucuAAAcuAAcuAGAAuccTsT 1067-1089 UCCUUAUCGAGAAUCUAAACUAA 7 cuuAucGAGAAucuAAAcuTsT 374-396 GAUUGAUGUUUACCGAAGUGUUG 9 uuGAuGuuuAccGAAGuGuTsT 205-227 UGGUGAGAUGCAGACCAUUUAAU 11 GuGAGAuGcAGAccAuuuATsT 1176-1198 ACUCUGAGUACAUUGGAAUAUGC 13 ucuGAGuAcAuuGGAAuAuTsT 386-408 CCGAAGUGUUGUUUGUCCAAUUC 15 GAAGuGuuGuuuGuccAAuTsT 416-438 AGUUAUUAUGGGCUAUAAUUGCA 17 uuAuuAuGGGcuAuAAuuGTsT 485-507 GGAAGGUGAAAGGUCACCUAAUG 19 AAGGuGAAAGGucAccuAATsT 476-498 UUUUACAAUGGAAGGUGAAAGGU 21 uuAcAAuGGAAGGuGAAAGTsT 486-508 GAAGGUGAAAGGUCACCUAAUGA 23 AGGuGAAAGGucAccuAAuTsT 487-509 AAGGUGAAAGGUCACCUAAUGAA 25 GGuGAAAGGucAccuAAuGTsT 1066-1088 UUCCUUAUCGAGAAUCUAAACUA 27 ccuuAucGAGAAucuAAAcTsT 1256-1278 AGCUCUUAUUAAGGAGUAUACGG 29 cucuuAuuAAGGAGuAuAcTsT 2329-2351 CAGAGAGAUUCUGUGCUUUGGAG 31 GAGAGAuucuGuGcuuuGGTsT 1077-1099 GAAUCUAAACUAACUAGAAUCCU 33 AucuAAAcuAAcuAGAAucTsT 1244-1266 ACUCACCAAAAAAGCUCUUAUUA 35 ucAccAAAAAAGcucuuAuTsT 637-659 AAGAGCUUUUUGAUCUUCUUAAU 37 GAGcuuuuuGAucuucuuATsT 1117-1139 GGCGUACAAGAACAUCUAUAAUU 39 cGuAcAAGAAcAucuAuAATsT 373-395 AGAUUGAUGUUUACCGAAGUGUU 41 AuuGAuGuuuAccGAAGuGTsT 1079-1101 AUCUAAACUAACUAGAAUCCUCC 43 cuAAAcuAAcuAGAAuccuTsT 383-405 UUACCGAAGUGUUGUUUGUCCAA 45 AccGAAGuGuuGuuuGuccTsT 200-222 GGUGGUGGUGAGAUGCAGACCAU 47 uGGuGGuGAGAuGcAGAccTsT single dose SDs 2nd screen @ screen position 25 nM [% (among in human duplex residual quadrupli- access. # SEQ I antisense sequence (5?-3?) name mRNA] cates) 385-407 2 UUGGAcAAAcAAcACUUCGTsT 23% 3% 347-369 4 GuAGAUGCUCcAAAcACcATsT AL-DP-6227 69% 10% 1078-1100 6 GGAUUCuAGUuAGUUuAGATsT AL-DP-6228 33% 2% 1067-1089 8 AGUUuAGAUUCUCGAuAAGTsT 2% 2% 374-396 10 AcACUUCGGuAAAcAUcAATsT AL-DP-6230 66% 11% 205-227 12 uAAAUGGUCUGcAUCUcACTsT 17% 1% 1176-1198 14 AuAUUCcAAUGuACUcAGATsT 9% 3% 386-408 16 AUUGGAcAAAcAAcACUUCTsT AL-DP-6233 24% 6% 416-438 18 cAAUuAuAGCCcAuAAuAATsT AL-DP-6234 91% 2% 485-507 20 UuAGGUGACCUUUcACCUUTsT AL-DP-6235 112% 4% 476-498 22 CUUUcACCUUCcAUUGuAATsT AL-DP-6236 69% 4% 486-508 24 AUuAGGUGACCUUUcACCUTsT AL-DP-6237 42% 2% 487-509 26 cAUuAGGUGACCUUUcACCTsT AL-DP-6238 45% 2% 1066-1088 28 GUUuAGAUUCUCGAuAAGGTsT 2% 1% 1256-1278 30 GuAuACUCCUuAAuAAGAGTsT AL-DP-6240 48% 2% 2329-2351 32 CcAAAGcAcAGAAUCUCUCTsT AL-DP-6241 41% 2% 1077-1099 34 GAUUUuAGUuAGUUuAGAUTsT 8% 2% 1244-1266 36 AuAAGAGCUUUUUUGGUGATsT 7% 1% 637-659 38 uAAGAAGAUcAAAAAGCUCTsT 6% 2% 1117-1139 40 UuAuAGAUGUUCUUGuACGTsT AL-DP-6245 12% 2% 373-395 42 cACUUCGGuAAAcAUcAAUTsT AL-DP-6246 28% 3% 1079-1101 44 AGGAUUCuAGUuAGUUuAGTsT AL-DP-6247 71% 4% 383-405 46 GGAcAAAcAAcACUUCGGUTsT 5% 2% 200-222 48 GGUCUGcAYCUcACcACcATsT AL-DP-6249 28% 3%


TABLE 2B 1st 2nd single single dose dose 3rd SDs 3rd screen @ SDs 1st screen @ SDs 2nd single screen 50 nM [% screen 25 nM [% screen dose (among duplex resudual (among resudual (among screen quadrup- name mRNA] quadruplicates) mRNA] quadruplicates) @25 nM licates) AD-12072 65% 2% 82% 5% AD-12073 84% 1% 61% 6% AD-12074 51% 3% 36% 9% AD-12075 56% 4% 36% 4% AD-12076 21% 4% 13% 3% AD-12077 11% 2% 6% 1% AD-12078 22% 3% 9% 2% AD-12079 22% 10% 15% 7% AD-12080 68% 4% 52% 13% AD-12081 34% 8% 35% 24% AD-12082 20% 2% 92% 5% AD-12083 85% 6% 63% 10% AD-12084 18% 6% 17% 4% AD-12085 13% 4% 12% 4% AD-12086 26% 5% 17% 3% AD-12087 95% 4% 80% 4% AD-12088 29% 6% 29% 2% AD-12089 69% 5% 64% 7% AD-12090 46% 15% 34% 5% AD-12091 16% 6% 17% 3% AD-12092 82% 26% 63% 5% AD-12093 84% 4% 70% 4% AD-12094 46% 3% 34% 3% AD-12095 14% 2% 13% 1% AD-12096 26% 11% 17% 1% AD-12097 23% 2% 21% 1% AD-12098 41% 14% 17% 3% AD-12099 57% 2% 48% 6% AD-12100 101% 11% 98% 8% AD-12101 46% 7% 32% 2% AD-12102 96% 17% 88% 18% AD-12103 19% 5% 20% 2% AD-12104 40% 8% 24% 2% AD-12105 39% 2% 35% 10% AD-12106 87% 6% 79% 19% AD-12107 29% 2% 32% 16% AD-12108 38% 4% 39% 8% AD-12109 49% 3% 44% 10% AD-12110 85% 5% 80% 14% AD-12111 64% 6% 71% 18% AD-12112 48% 4% 41% 5% AD-12113 13% 0% 14% 3% AD-12114 32% 6% 16% 4% AD-12115 8% 4% 7% 5% AD-12116 74% 5% 61% 7% AD-12117 21% 4% 20% 2% AD-12118 44% 4% 42% 6% AD-12119 37% 4% 24% 3% AD-12120 22% 2% 15% 4% AD-12121 32% 1% 22% 2% AD-12122 36% 16% 10% 5% AD-12123 28% 1% 16% AD-12124 28% 2% 16% AD-12125 15% 1% 14% AD-12126 51% 22% 27% AD-12127 54% 4% 42% 9% AD-12128 29% 1% 20% 2% AD-12129 22% 3% 19% 3% AD-12130 53% 6% 42% 7% AD-12131 28% 5% 22% 3% AD-12132 88% 2% 90% 18% AD-12133 34% 2% 26% 6% AD-12134 18% 3% 14% 2% AD-12135 50% 6% 37% 4% AD-12136 42% 19% 22% 2% AD-12137 85% 12% 92% 4% AD-12138 47% 6% 49% 1% AD-12139 80% 5% 72% 4% AD-12140 97% 22% 67% 9% AD-12141 120% 4% 107% 10% AD-12142 55% 8% 33% 4% AD-12143 64% 34% 19% 2% AD-12144 58% 29% 17% 2% AD-12145 27% 8% 18% 2% AD-12146 19% 20% 15% 1% AD-12147 29% 9% 35% 3% AD-12148 30% 3% 56% 5% AD-12149 8% 2% 12% 3% AD-12150 31% 2% 31% 7% AD-12151 9% 5% 14% 2% AD-12152 3% 3% 23% 3% AD-12153 20% 6% 34% 4% AD-12154 24% 7% 44% 3% AD-12155 33% 6% 53% 11% AD-12156 35% 5% 40% 5% AD-12157 8% 3% 23% 4% AD-12158 13% 2% 22% 5% AD-12159 34% 6% 46% 5% AD-12160 19% 3% 31% 4% AD-12161 88% 4% 83% 7% AD-12162 26% 7% 32% 7% AD-12163 55% 9% 40% 3% AD-12164 21% 3% AD-12165 30% 3% 41% 4% AD-12166 9% 10% 22% 9% AD-12167 26% 3% 30% 2% AD-12168 54% 4% 59% 20% AD-12169 41% 4% 51% 16% AD-12170 43% 4% 52% 20% AD-12171 67% 3% 73% 25% AD-12172 53% 15% 37% 2% AD-12173 39% 0% 39% 0% AD-12174 41% 5% 27% 0% AD-12175 29% 0% 38% 14% AD-12176 43% 2% 56% 25% AD-12177 68% 6% 74% 30% AD-12178 41% 4% 41% 6% AD-12179 53% 5% 44% 5% AD-12180 16% 2% 13% 4% AD-12181 19% 3% 14% 2% AD-12182 16% 4% 18% 8% AD-12183 26% 3% 19% 4% AD-12184 54% 2% 77% 8% AD-12185 8% 1% 9% 1% AD-12186 35% 3% 41% 6% AD-12187 34% 17% 27% 1% AD-12188 30% 3% 27% 4% AD-12189 51% 4% 48% 5% AD-12190 33% 2% 26% 4% AD-12191 20% 2% 13% 0% AD-12192 21% 1% 23% 10% AD-12193 64% 8% 98% 6% AD-12194 8% 2% 15% 4% AD-12195 34% 2% 48% 3% AD-12196 34% 2% 51% 3% AD-12197 75% 4% 93% 6% AD-12198 55% 5% 48% 2% AD-12199 102% 6% 118% 9% AD-12200 75% 6% 60% 12% AD-12201 42% 3% 16% 4% AD-12202 29% 4% 9% 3% AD-12203 114% 14% 89% 20% AD-12204 64% 7% 26% 5% AD-12205 66% 12% 35% 4% AD-12206 46% 3% 32% 12% AD-12207 57% 5% 40% 6% AD-12208 30% 8% 10% 5% AD-12209 101% 6% 102% 23% AD-12210 38% 11% 27% 14% AD-12211 16% 6% 10% 5% AD-12212 59% 8% 65% 5% AD-12213 24% 9% 12% 2% AD-12214 67% 14% 70% 12% AD-12215 29% 13% 13% 4% AD-12216 36% 4% 13% 1% AD-12217 36% 9% 11% 2% AD-12218 35% 5% 17% 3% AD-12219 41% 9% 14% 1% AD-12220 37% 5% 23% 3% AD-12221 58% 7% 39% 6% AD-12222 74% 9% 53% 3% AD-12223 74% 10% 67% 7% AD-12224 24% 2% 11% 2% AD-12225 75% 5% 76% 14% AD-12226 45% 8% 40% 3% AD-12227 61% 6% 47% 5% AD-12228 28% 3% 25% 5% AD-12229 54% 13% 37% 6% AD-12230 70% 17% 65% 4% AD-12231 32% 12% 22% 6% AD-12232 30% 3% 17% 2% AD-12233 38% 2% 32% 3% AD-12234 90% 5% 95% 7% AD-12235 57% 7% 46% 3% AD-12236 34% 8% 16% 2% AD-12237 42% 9% 32% 8% AD-12238 42% 6% 34% 6% AD-12239 42% 3% 40% 4% AD-12240 47% 6% 36% 5% AD-12241 69% 5% 70% 8% AD-12242 61% 2% 47% 3% AD-12243 26% 7% 15% 1% AD-12244 25% 6% 15% 1% AD-12245 65% 6% 83% 13% AD-12246 29% 7% 31% 6% AD-12247 57% 13% 50% 3% AD-12248 36% 8% 20% 3% 15% 7% AD-12249 44% 3% 70% 11% 103% 34% AD-12250 47% 5% 18% 5% 17% 4% AD-12251 121% 28% 35% 8% 60% 42% AD-12252 94% 15% 8% 3% 5% 3% AD-12253 94% 33% 42% 8% 49% 27% AD-12254 101% 58% 70% 5% 80% 32% AD-12255 163% 37% 38% 6% 36% 10% AD-12256 112% 62% 18% 3% 9% 4% AD-12257 10% 4% 9% 2% 6% 2% AD-12258 27% 9% 18% 3% 20% 6% AD-12259 20% 5% 12% 2% 13% 5% AD-12260 22% 7% 81% 7% 65% 13% AD-12261 122% 11% 66% 7% 80% 22% AD-12262 57% 30% 33% 6% 44% 18% AD-12263 177% 57% 85% 11% 84% 15% AD-12264 37% 6% 10% 1% 10% 4% AD-12265 40% 8% 17% 1% 20% 10% AD-12266 33% 9% 9% 1% 8% 4% AD-12267 34% 13% 11% 1% 6% 2% AD-12268 34% 6% 11% 1% 9% 2% AD-12269 54% 6% 33% 4% 29% 7% AD-12270 52% 5% 29% 4% 27% 6% AD-12271 53% 7% 27% 3% 19% 6% AD-12272 85% 15% 57% 7% 51% 16% AD-12273 36% 6% 26% 2% 30% 5% AD-12274 75% 21% 40% 2% 50% 19% AD-12275 29% 9% 8% 1% 8% 4% AD-12276 45% 19% 15% 2% 16% 12% AD-12277 58% 17% 32% 2% 55% 14% AD-12278 120% 35% 96% 10% 124% 38% AD-12279 47% 29% 17% 1% 12% 4% AD-12280 2% 0% 3% 1% AD-12281 2% 0% 5% 2% AD-12282 3% 0% 25% 5% AD-12283 3% 1% 35% 4% AD-12284 5% 2% 49% 8% AD-12285 7% 7% 21% 26% AD-12286 28% 34% 12% 7% AD-12287 40% 21% 51% 23% AD-12288 26% 7% 155% 146% AD-12289 43% 21% 220% 131% AD-12290 2% 1% 81% 23% AD-12291 4% 1% 70% 3% AD-12292 2% 3% 6% 2% AD-12293 4% 2% 36% 3% AD-12294 10% 6% 38% 3% AD-12295 29% 31% 37% 3% AD-12296 82% 4% 89% 2% AD-12297 75% 3% 65% 2% AD-12298 73 4% 60% 3% AD-12299 76% 4% 65% 4% AD-12300 36% 4% 15% 1% AD-12301 33% 4% 18% 2% AD-12302 66% 5% 65% 3% AD-12303 35% 6% 17% 2% AD-12304 70% 8% 70% 6% AD-12305 63% 8% 80% 7% AD-12306 23% 6% 20% 3% AD-12307 78% 10% 58% 5% AD-12308 27% 8% 15% 2% AD-12309 58% 11% 42% 3% AD-12310 106% 23% 80% 2% AD-12311 73% 12% 60% 2% AD-12312 39% 3% 36% 3% AD-12313 64% 9% 49% 6% AD-12314 28% 7% 14% 6% AD-12315 31% 7% 13% 2% AD-12316 42% 5% 14% 2% AD-12317 34% 9% 15% 5% AD-12318 46% 4% 28% 4% AD-12319 77% 3% 56% 4% AD-12320 55% 7% 41% 3% AD-12321 21% 3% 10% 2% AD-12322 27% 8% 30% 12% AD-12323 26% 7% 35% 18% AD-12324 27% 8% 27% 14% AD-12325 32% 12% 32% 22% AD-12326 42% 22% 45% 41% AD-12327 36% 14% 37% 32% AD-12328 45% 2% 31% 3% AD-12329 61% 4% 34% 3% AD-12330 63% 5% 38% 4% AD-12331 50% 2% 26% 5% AD-12332 80% 4% 51% 7% AD-12333 34% 6% 12% 2% AD-12334 27% 2% 18% 3% AD-12335 84% 6% 60% 7% AD-12336 45% 4% 36% 4% AD-12337 30% 7% 19% 2%

TABLE 3 single SDs dose 2nd screen @ screen SEQ SEQ 25 nM [% (among ID ID duplex residual quadru- sequence (5?-3?) NO. sequence (5?-3?) NO. name mRNA] plicates) ccAuuAcuAcAGuAGcAcuTsT 582 AGUGCuACUGuAGuAAUGGTsT 583 AD-14085 19% 1% AucuGGcAAccAuAuuucuTsT 584 AGAAAuAUGGUUGCcAGAUTsT 585 AD-14086 38% 1% GAuAGcuAAAuuAAAccAATsT 586 UUGGUUuAAUUuAGCuAUCTsT 587 AD-14087 75% 10%? AGAuAccAuuAcuAcAGuATsT 588 uACUGuAGuAAUGGuAUCUTsT 589 AD-14088 22% 8% GAuuGuucAucAAuuGGcGTsT 590 CGCcAAUUGAUGAAcAAUCTsT 591 AD-14089 70% 12%? GcuuucuccucGGcucAcuTsT 592 AGuGAGCCGAGGAGAAAGCTsT 593 AD-14090 79% 11%? GGAGGAuuGGcuGAcAAGATsT 594 UCUUGUcAGCcAAUCCUCCTsT 595 AD-14091 29% 3% uAAuGAAGAGuAuAccuGGTsT 596 CcAGGuAuACUCUUcAUuATsT 597 AD-14092 23% 2% uuucAccAAAccAuuuGuATsT 598 uAcAAAUGGUUUGGUGAAATsT 599 AD-14093 60% 2% cuuAuuAAGGAGuAuAcGGTsT 600 CCGuAuACUCCUuAAuAAGTsT 601 AD-14094 11% 3% GAAAucAGAuGGAcGuAAGTsT 602 CUuACGUCcAUCUGAUUUCTsT 603 AD-14095 10% 2% cAGAuGucAGcAuAAGcGATsT 604 UCGCUuAUGCUGAcAUCUGTsT 605 AD-14096 27% 2% AucuAAcccuAGuuGuAucTsT 606 GAuAcAACuAGGGUuAGAUTsT 607 AD-14097 45% 6% AAGAGcuuGuuAAAAucGGTsT 608 CCGAUUUuAAcAAGCUCUUTsT 609 AD-14098 50% 10%? uuAAGGAGuAuAcGGAGGATsT 610 UCCUCCGuAuACUCCUuAATsT 611 AD-14099 12% 4% uuGcAAuGuAAAuAcGuAuTsT 612 AuACGuAUUuAcAUUGcAATsT 613 AD-14100 49% 7% ucuAAcccuAGuuGuAuccTsT 614 GGAuAcAACuAGGGUuAGATsT 615 AD-14101 36% 1% cAuGuAucuuuuucucGAuTsT 616 AUCGAGAAAAAGAuAcAUGTsT 617 AD-14102 49% 3% GAuGucAGcAuAAGcGAuGTsT 618 cAUCGCUuAUGCUGAcAUCTsT 619 AD-14103 74% 5% ucccAAcAGGuAcGAcAccTsT 620 GGUGUCGuACCUGUUGGGATsT 621 AD-14104 27% 3% uGcucAcGAuGAGuuuAGuTsT 622 ACuAAACUcAUCGUGAGcATsT 623 AD-14105 34% 4% AGAGcuuGuuAAAAucGGATsT 624 UCCGAUUUuAAcAAGCUCUTsT 625 AD-14106 ?9% 2% GcGuAcAAGAAcAucuAuATsT 626 uAuAGAUGUUCUUGuACGCTsT 627 AD-14107 ?5% 1% GAGGuuGuAAGccAAuGuuTsT 628 AAcAUUGGCUuAcAACCUCTsT 629 AD-14108 15% 1% AAcAGGuAcGAcAccAcAGTsT 630 CUGUGGUGUCGuACCUGUUTsT 631 AD-14109 91% 2% AAcccuAGuuGuAucccucTsT 632 GAGGGAuAcAACuAGGGUUTsT 633 AD-14110 66% 5% GcAuAAGcGAuGGAuAAuATsT 634 uAUuAUCcAUCGCUuAUGCTsT 635 AD-14111 33% 3% AAGcGAuGGAuAAuAccuATsT 636 uAGGuAUuAUCcAUCGCUUTsT 637 AD-14112 51% 3% uGAuccuGuAcGAAAAGAATsT 638 UUCUUUUCGuAcAGGAUcATsT 639 AD-14113 22% 3% AAAAcAuuGGccGuucuGGTsT 640 CcAGAACGGCcAAUGUUUUTsT 641 AD-14114 117%? 8% cuuGGAGGGcGuAcAAGAATsT 642 UUCUUGuACGCCCUCcAAGTsT 643 AD-14115 50% 8% GGcGuAcAAGAAcAucuAuTsT 644 AuAGAUGUUCUUGuACGCCTsT 645 AD-14116 14% 3% AcucuGAGuAcAuuGGAAuTsT 646 AUUCcAAUGuACUcAGAGUTsT 647 AD-14117 12% 4% uuAuuAAGGAGuAuAcGGATsT 648 UCCGuAuACUCCUuAAuAATsT 649 AD-14118 26% 4% uAAGGAGuAuAcGGAGGAGTsT 650 CUCCUCCGuAuACUCCUuATsT 651 AD-14119 24% 5% AAAucAAuAGucAAcuAAATsT 652 UUuAGUUGACuAUUGAUUUTsT 653 AD-14120 ?8% 1% AAucAAuAGucAAcuAAAGTsT 654 CUUuAGUUGACuAUUGAUUTsT 655 AD-14121 24% 2% uucucAGuAuAcuGuGuAATsT 656 UuAcAcAGuAuACUGAGAATsT 657 AD-14122 10% 1% uGuGAAAcAcucuGAuAAATsT 658 UUuAUcAGAGUGUUUcAcATsT 659 AD-14123 ?8% 1% AGAuGuGAAucucuGAAcATsT 660 UGUUcAGAGAUUcAcAUCUTsT 661 AD-14124 ?9% 2% AGGuuGuAAGccAAuGuuGTsT 662 cAAcAUUGGCUuAcAACCUTsT 663 AD-14125 114%? 6% uGAGAAAucAGAuGGAcGuTsT 664 ACGUCcAUCUGAUUUCUcATsT 665 AD-14126 ?9% 1% AGAAAucAGAuGGAcGuAATsT 666 UuACGUCcAUCUGAUUUCUTsT 667 AD-14127 57% 6% AuAucccAAcAGGuAcGAcTsT 668 GUCGuACCUGUUGGGAuAUTsT 669 AD-14128 104%? 6% cccAAcAGGuAcGAcAccATsT 670 UGGUGUCGuACCUGUUGGGTsT 671 AD-14129 21% 2% AGuAuAcuGAAGAAccucuTsT 672 AGAGGUUCUUcAGuAuACUTsT 673 AD-14130 57% 6% AuAuAuAucAGccGGGcGcTsT 674 GCGCCCGGCUGAuAuAuAUTsT 675 AD-14131 93% 6% AAucuAAcccuAGuuGuAuTsT 676 AuAcAACuAGGGUuAGAUUTsT 677 AD-14132 75% 8% cuAAcccuAGuuGuAucccTsT 678 GGGAuAcAACuAGGGUuAGTsT 679 AD-14133 66% 4% cuAGuuGuAucccuccuuuTsT 680 AAAGGAGGGAuAcAACuAGTsT 681 AD-14134 44% 6% AGAcAucuGAcuAAuGGcuTsT 682 AGCcAUuAGUcAGAUGUCUTsT 683 AD-14135 55% 6% GAAGcucAcAAuGAuuuAATsT 684 UuAAAUcAUUGUGAGCUUCTsT 685 AD-14136 29% 3% AcAuGuAucuuuuucucGATsT 686 UCGAGAAAAAGAuAcAUGUTsT 687 AD-14137 40% 3% ucGAuucAAAucuuAAcccTsT 688 GGGUuAAGAUUUGAAUCGATsT 689 AD-14138 39% 5% ucuuAAcccuuAGGAcucuTsT 690 AGAGUCCuAAGGGUuAAGATsT 691 AD-14139 71% 11%? GcucAcGAuGAGuuuAGuGTsT 692 cACuAAACUcAUCGUGAGCTsT 693 AD-14140 43% 15%? cAuAAGcGAuGGAuAAuAcTsT 694 GuAUuAUCcAUCGCUuAUGTsT 695 AD-14141 33% 6% AuAAGcGAuGGAuAAuAccTsT 696 GGuAUuAUCcAUCGCUuAUTsT 697 AD-14142 51% 14%? ccuAAuAAAcuGcccucAGTsT 698 CUGAGGGcAGUUuAUuAGGTsT 699 AD-14143 42% 1% ucGGAAAGuuGAAcuuGGuTsT 700 ACcAAGUUcAACUUUCCGATsT 701 AD-14144 ?4% 4% GAAAAcAuuGGccGuucuGTsT 702 cAGAACGGCcAAUGUUUUCTsT 703 AD-14145 92% 5% AAGAcuGAucuucuAAGuuTsT 704 AACUuAGAAGAUcAGUCUUTsT 705 AD-14146 13% 2% GAGcuuGuuAAAAucGGAATsT 706 UUCCGAUUUuAAcAAGCUCTsT 707 AD-14147 ?8% 1% AcAuuGGccGuucuGGAGcTsT 708 GCUCcAGAACGGCcAAUGUTsT 709 AD-14148 80% 7% AAGAAcAucuAuAAuuGcATsT 710 UGcAAUuAuAGAUGUUCUUTsT 711 AD-14149 44% 7% AAAuGuGucuAcucAuGuuTsT 712 AAcAUGAGuAGAcAcAUUUTsT 713 AD-14150 32% 29%? uGucuAcucAuGuuucucATsT 714 UGAGAAAcAUGAGuAGAcATsT 715 AD-14151 75% 11%? GuAuAcuGuGuAAcAAucuTsT 716 AGAUUGUuAcAcAGuAuACTsT 717 AD-14152 ?8% 5% uAuAcuGuGuAAcAAucuATsT 718 uAGAUUGUuAcAcAGuAuATsT 719 AD-14153 17% 11%? cuuAGuAGuGuccAGGAAATsT 720 UUUCCUGGAcACuACuAAGTsT 721 AD-14154 16% 4% ucAGAuGGAcGuAAGGcAGTsT 722 CUGCCUuACGUCcAUCUGATsT 723 AD-14155 11% 1% AGAuAAAuuGAuAGcAcAATsT 724 UUGUGCuAUcAAUUuAUCUTsT 725 AD-14156 10% 1% cAAcAGGuAcGAcAccAcATsT 726 UGUGGUGUCGuACCUGUUGTsT 727 AD-14157 29% 3% uGcAAuGuAAAuAcGuAuuTsT 728 AAuACGuAUUuAcAUUGcATsT 729 AD-14158 51% 3% AGucAGAAuuuuAucuAGATsT 730 UCuAGAuAAAAUUCUGACUTsT 731 AD-14159 53% 5% cuAGAAAucuuuuAAcAccTsT 732 GGUGUuAAAAGAUUUCuAGTsT 733 AD-14160 40% 3% AAuAAAucuAAcccuAGuuTsT 734 AACuAGGGUuAGAUUuAUUTsT 735 AD-14161 83% 7% AAuuuucuGcucAcGAuGATsT 736 UcAUCGUGAGcAGAAAAUUTsT 737 AD-14162 44% 6% GcccucAGuAAAuccAuGGTsT 738 CcAUGGAUUuACUGAGGGCTsT 739 AD-14163 57% 3% AcGuuuAAAAcGAGAucuuTsT 740 AAGAUCUCGUUUuAAACGUTsT 741 AD-14164 ?4% 1% AGGAGAuAGAAcGuuuAAATsT 742 UUuAAACGUUCuAUCUCCUTsT 743 AD-14165 11% 1% GAccGucAuGGcGucGcAGTsT 744 CUGCGACGCcAUGACGGUCTsT 745 AD-14166 90% 5% AccGucAuGGcGucGcAGcTsT 746 GCUGCGACGCcAUGACGGUTsT 747 AD-14167 49% 1% GAAcGuuuAAAAcGAGAucTsT 748 GAUCUCGUUUuAAACGUUCTsT 749 AD-14168 12% 2% uuGAGcuuAAcAuAGGuAATsT 750 UuACCuAUGUuAAGCUcAATsT 751 AD-14169 66% 4% AcuAAAuuGAucucGuAGATsT 752 UCuACGAGAUcAAUUuAGUTsT 753 AD-14170 52% 6% ucGuAGAAuuAucuuAAuATst 754 uAUuAAGAuAAUUCuACGATsT 755 AD-14171 42% 4% GGAGAuAGAAcGuuuAAAATsT 756 UUUuAAACGUUCuAUCUCCTsT 757 AD-14172 ?3% 1% AcAAcuuAuuGGAGGuuGuTsT 758 AcAACCUCcAAuAAGUUGUTsT 759 AD-14173 29% 2% uGAGcuuAAcAuAGGuAAATsT 760 UUuACCuAUGUuAAGCUcATsT 761 AD-14174 69% 2% AucucGuAGAAuuAucuuATsT 762 uAAGAuAAUUCuACGAGAUTsT 763 AD-14175 53% 3% cuGcGuGcAGucGGuccucTsT 764 GAGGACCGACUGcACGcAGTsT 765 AD-14176 111%? 4% cAcGcAGcGcccGAGAGuATsT 766 uACUCUCGGGCGCUGCGUGTsT 767 AD-14177 87% 6% AGuAccAGGGAGAcuccGGTsT 768 CCGGAGUCUCCCUGGuACUTsT 769 AD-14178 59% 2% AcGGAGGAGAuAGAAcGuuTsT 770 AACGUUCuAUCUCCUCCGUTsT 771 AD-14179 ?9% 2% AGAAcGuuuAAAAcGAGAuTsT 772 AUCUCGUUUuAAACGUUCUTsT 773 AD-14180 43% 2% AAcGuuuAAAAcGAGAucuTsT 774 AGAUCUCGUUUuAAACGUUTsT 775 AD-14181 70% 10%? AGcuuGAGcuuAAcAuAGGTsT 776 CCuAUGUuAAGCUcAAGCUTsT 777 AD-14182 100%? 7% AGcuuAAcAuAGGuAAAuATsT 778 uAUUuACCuAUGUuAAGCUTsT 779 AD-14183 60% 5% uGAGAcuAcAAAAccuAucTsT 780 GAuAGGUUUUGuAGCUCuATsT 781 AD-14184 129%? 6% uAGuuGuAuccuccuuuuATsT 782 uAAAGGAGGGAuAcAACuATsT 783 AD-14185 62% 4% AccAcccAGAcAucuGAcuTsT 784 AGUcAGAUGUCUGGGUGGUTsT 785 AD-14186 42% 3% AGAAAcuAAAuuGAucucGTsT 786 CGAGAUcAAUUuAGUUUCUTsT 787 AD-14187 123%? 12%? ucucGuAGAAuuAucuuAATsT 788 UuAAGAuAAUUCuACGAGATsT 789 AD-14188 38% 2% cAAcuuAuuGGAGGuuGuATsT 790 uAcAACCUCcAAuAAGUUGTsT 791 AD-14189 13% 1% uuGuAucccuccuuuAAGuTsT 792 ACUuAAAGGAGGGAuAcAATsT 793 AD-14190 59% 3% ucAcAAcuuAuuGGAGGuuTsT 794 AACCUCcAAuAAGUUGUGATsT 795 AD-14191 93% 3% AGAAcuGuAcucuucucAGTsT 796 CUGAGAAGAGuAcAGUUCUTsT 797 AD-14192 45% 5% GAGcuuAAcAuAGGuAAAuTsT 798 AUUuACCuAUGUuAAGCUCTsT 799 AD-14193 57% 3% cAccAAcAucuGuccuuAGTsT 800 CuAAGGAcAGAUGUUGGUGTsT 801 AD-14194 51% 4% AAAGcccAcuuuAGAGuAuTsT 802 AuACUCuAAAGUGGGCUUUTsT 803 AD-14195 77% 5% AAGcccAcuuuAGAGuAuATsT 804 uAuACUCuAAAGUGGGCUUTsT 805 AD-14196 42% 6% GAccuuAuuuGGuAAucuGTsT 806 cAGAUuACcAAAuAAGGUCTsT 807 AD-14197 15% 2% GAuuAAcGuAcucAAGAcuTsT 808 AGUCUUGAGuAcAUuAAUCTsT 809 AD-14198 12% 2% cuuuAAGAGGccuAAcucATsT 810 UGAGUuAGGCCUCUuAAAGTsT 811 AD-14199 18% 2% uuAAAccAAAcccuAuuGATsT 812 UcAAuAGGGUUUGGUUuAATsT 813 AD-14200 72% 9% ucuGuuGGAGAucuAuAAuTsT 814 AUuAuAGAUCUCcAAcAGATsT 815 AD-14201 ?9% 3% cuGAuGuuucuGAGAGAcuTsT 816 AGUCUCUcAGAAAcAUcAGTsT 817 AD-14202 25% 3% GcAuAcucuAGucGuucccTsT 818 GGGAACGACuAGAGuAUGCTsT 819 AD-14203 21% 1% GuuccuuAucGAGAAucuATsT 820 uAGAUUCUCGAuAAGGAACTsT 821 AD-14204 ?4% 2% GcAcuuGGAucucucAcAuTsT 822 AUGUGAGAGAUCcAAGUGCTsT 823 AD-14205 ?5% 1% AAAAAAGGAAcuAGAuGGcTsT 824 GCcAUCuAGUUCCUUUUUUTsT 825 AD-14206 79% 6% AGAGcAGAuuAccucuGcGTsT 826 CGcAGAGGuAAUCUGCUCUTsT 827 AD-14207 55% 2% AGcAGAuuAccucuGcGAGTsT 828 CUCGcAGAGGuAAUCUGCUTsT 829 AD-14208 100%? 4% cccuGAcAGAGuucAcAAATsT 830 UUUGUGAACUCUGUcAGGGTsT 831 AD-14209 34% 3% GuuuAccGAAGuGuuGuuuTsT 832 AAAcAAcACUUCGGuAAACTsT 833 AD-14210 13% 2% uuAcAGuAcAcAAcAAGGATsT 834 UCCUUGUUGUGuACUGuAATsT 835 AD-14211 ?9% 1% AcuGGAucGuAAGAAGGcATsT 836 UGCCUUCUuACGAUCcAGUTsT 837 AD-14212 20% 3% GAGcAGAuuAccucuGcGATsT 838 UCGcAGAGGuAAUCUGCUCTsT 839 AD-14213 48% 5% AAAAGAAGuuAGuGuAcGATsT 840 UCGuAcACuAACUUCUUUUTsT 841 AD-14214 28% 18%? GAccAuuuAAuuuGGcAGATsT 842 UCUGCcAAAUuAAAUGGUCTsT 843 AD-14215 132%? 0% GAGAGGAGuGAuAAuuAAATsT 844 UUuAAUuAUcACUCCUCUCTsT 845 AD-14216 ?3% 0% cuGGAGGAuuGGcuGAcAATsT 846 UUGUcAGCcAAUCCUCcAGTsT 847 AD-14217 19% 1% cucuAGucGuucccAcucATsT 848 UGAGUGGGAACGACuAGAGTsT 849 AD-14218 67% 8% GAuAccAuuAcuAcAGuAGTsT 850 CuACUGuAGuAAUGGuAUCTsT 851 AD-14219 76% 4% uucGucuGcGAAGAAGAAATsT 852 UUUCUUCUUCGcAGACGAATsT 853 AD-14220 33% 8% GAAAAGAAGuuAGuGuAcGTsT 854 CGuAcACuAACUUCUUUUCTsT 855 AD-14221 25% 2% uGAuGuuuAccGAAGuGuuTsT 856 AAcACUUCGGuAAAcAUcATsT 857 AD-14222 ?7% 2% uGuuuGuccAAuucuGGAuTsT 858 AUCcAGAAUUGGAcAAAcATsT 859 AD-14223 19% 2% AuGAAGAGuAuAccuGGGATsT 860 UCCcAGGuAuACUCUUcAUTsT 861 AD-14224 13% 1% GcuAcucuGAuGAAuGcAuTsT 862 AUGcAUUcAUcAGAGuAGCTsT 863 AD-14225 15% 2% GcccuuGuAGAAAGAAcAcTsT 864 GUGUUCUUUCuAcAAGGGCTsT 865 AD-14226 11% 0% ucAuGuuccuuAucGAGAATsT 866 UUCUCGAuAAGGAAcAUGATsT 867 AD-14227 5% 1% GAAuAGGGuuAcAGAGuuGTsT 868 cAACUCUGuAACCCuAUUCTsT 869 AD-14228 34% 3% cAAAcuGGAucGuAAGAAGTsT 870 CUUCUuACGAUCcAGUUUGTsT 871 AD-14229 15% 2% cuuAuuuGGuAAucuGcuGTsT 872 cAGcAGAUuACcAAAuAAGTsT 873 AD-14230 20% 1% AGcAAuGuGGAAAccuAAcTsT 874 GUuAGGUUUCcAcAUUGCUTsT 875 AD-14231 18% 1% AcAAuAAAGcAGAcccAuuTsT 876 AAUGGGUCUGCUUuAUUGUTsT 877 AD-14232 21% 1% AAccAcuuAGuAGuGuccATsT 878 UGGAcACuACuAAGUGGUUTsT 879 AD-14233 106%? 12%? AGucAAGAGccAucuGuAGTsT 880 CuAcAGAUGGCUCUUGACUTsT 881 AD-14234 35% 3% cucccuAGAcuucccuAuuTsT 882 AAuAGGGAAGUCuAGGGAGTsT 883 AD-14235 45% 4% AuAGcuAAAuuAAAccAAATsT 884 UUUGGUUuAAUUuAGCuAUTsT 885 AD-14236 23% 3% uGGcuGGuAuAAuuccAcGTsT 886 CGUGGAAUuAuACcAGCcATsT 887 AD-14237 79% 9% uuAuuuGGuAAucuGcuGuTsT 888 AcAGcAGAUuACcAAAuAATsT 889 AD-14238 92% 7% AAcuAGAuGGcuuucucAGTsT 890 CUGAGAAAGCcAUCuAGUUTsT 891 AD-14239 20% 2% ucAuGGcGucGcAGccAAATsT 892 UUUGGCUGCGACGCcAUGATsT 893 AD-14240 71% 6% AcuGGAGGAuuGGcuGAcATsT 894 UGUcAGCcAAUCCUCcAGUTsT 895 AD-14241 14% 1% cuAuAAuuGcAcuAucuuuTsT 896 AAAGAuAGUGcAAUuAuAGTsT 897 AD-14242 11% 2% AAAGGucAccuAAuGAAGATsT 898 UCUUcAUuAGGUGACCUUUTsT 899 AD-14243 11% 1% AuGAAuGcAuAcucuAGucTsT 900 GACuAGAGuAUGcAUUcAUTsT 901 AD-14244 15% 2% AAcAuAuuGAAuAAGccuGTsT 902 cAGGCUuAUUcAAuAUGUUTsT 903 AD-14245 80% 7% AAGAAGGcAGuuGAccAAcTsT 904 GUUGGUcAACAGCCUUCUUTsT 905 AD-14246 57% 5% GAuAcuAAAAGAAcAAucATsT 906 UGAUUGUUCUUUuAGuAUCTsT 907 AD-14247 ?9% 3% AuAcuGAAAAucAAuAGucTsT 908 GACuAUUGAUUUUcAGuAUTsT 909 AD-14248 39% 4% AAAAAGGAAcuAGAuGGcuTsT 910 AGCcAUCuAGUUCCUUUUUTsT 911 AD-14249 64% 2% GAAcuAGAuGGcuuucucATsT 912 UGAGAAAGCcAUCuAGUUCTsT 913 AD-14250 18% 2% GAAAccuAAcuGAAGAccuTsT 914 AGGUCUUcAGUuAGGUUUCTsT 915 AD-14251 56% 6% uAcccAucAAcAcuGGuAATsT 916 UuACcAGUGUUGAUGGGuATsT 917 AD-14252 48% 6% AuuuuGAuAucuAcccAuuTsT 918 AAUGGGuAGAuAUcAAAAUTsT 919 AD-14253 39% 5% AucccuAuAGuucAcuuuGTsT 920 cAAAGUGAACuAuAGGGAUTsT 921 AD-14254 44% 8% AuGGGcuAuAAuuGcAcuATsT 922 uAGUGcAAUuAuAGCCcAUTsT 923 AD-14255 108%? 8% AGAuuAccucuGcGAGcccTsT 924 GGGCUCGcAGAGGuAAUCUTsT 925 AD-14256 108%? 6% uAAuuccAcGuAcccuucATsT 926 UGAAGGGuACGUGGAAUuATsT 927 AD-14257 23% 2% GucGuucccAcucAGuuuuTsT 928 AAAACuGAGuGGGAACGACTsT 929 AD-14258 21% 3% AAAucAAucccuGuuGAcuTsT 930 AGUcAAcAGGGAUUGAUUUTsT 931 AD-14259 19% 2% ucAuAGAGcAAAGAAcAuATsT 932 uAUGUUCUUUGCUCuAUGATsT 933 AD-14260 10% 1% uuAcuAcAGuAGcAcuuGGTsT 934 CcAAGUGCuACUGuAGuAATsT 935 AD-14261 76% 3% AuGuGGAAAccuAAcuGAATsT 936 UUcAGUuAGGUUUCcAcAUTsT 937 AD-14262 13% 2% uGuGGAAAccuAAcuGAAGTsT 938 CUUcAGUuAGGUUUCcAcATsT 939 AD-14263 14% 2% uGuuccuuAAAuGAAAGGGTsT 940 CCCUUUcAUUuAAGGAAGATsT 941 AD-14264 65% 3% uGAAGAAccucuAAGucAATsT 942 UUGACUuAGAGGUUCUUcATsT 943 AD-14265 13% 1% AGAGGucuAAAGuGGAAGATsT 944 UCUUCcACUUuAGACCUCUTsT 945 AD-14266 18% 3% AuAucuAcccAuuuuucuGTsT 946 cAGAAAAAUGGGuAGAuAUTsT 947 AD-14267 50% 9% uAAGccuGAAGuGAAucAGTsT 948 CUGAUUcACUUcAGGCUuATsT 949 AD-14268 13% 3% AGAuGcAGAccAuuuAAuuTsT 950 AAUuAAAUGGUCUGcAUCUTsT 951 AD-14269 19% 4% AGuGuuGuuuGuccAAuucTsT 952 GAAUUGGAcAAAcAAcACUTsT 953 AD-14270 11% 2% cuAuAAuGAAGAGcuuuuuTsT 954 AAAAAGCUCUUcAUuAuAGTsT 955 AD-14271 11% 1% AGAGGAGuGAuAAuuAAAGTsT 956 CUUuAAUuAUcACUCCUCUTsT 957 AD-14272 ?7% 1% uuucucuGuuAcAAuAcAuTsT 958 AUGuAUUGuAAcAGAGAAATsT 959 AD-14273 14% 2% AAcAucuAuAAuuGcAAcATsT 960 UGUUGcAAUuAuAGAUGUUTsT 961 AD-14274 73% 4% uGcuAGAAGuAcAuAAGAcTsT 962 GUCUuAUGuACUUCuAGcATsT 963 AD-14275 10% 1% AAuGuAcucAAGAcuGAucTsT 964 GAUcAGUCUUGACuAcAUUTsT 965 AD-14276 89% 2% GuAcucAAGAcuGAucuucTsT 966 GAAGAUcAGUCUUGAGuACTsT 967 AD-14277 ?7% 1% cAcucuGAuAAAcucAAuGTsT 968 cAUUGAGUUuAUcAGAGUGTsT 969 AD-14278 12% 1% AAGAGcAGAuuAccucuGcTsT 970 GcAGAGGuAAUCUGCUCUUTsT 971 AD-14279 104%? 3% ucuGcGAGcccAGAucAAcTsT 972 GUUGAUCUGGGCUCGcAGATsT 973 AD-14280 21% 2% AAcuuGAGccuuGuGuAuATsT 974 uAuAcAcAAGGCUcAAGUUTsT 975 AD-14281 43% 3% GAAuAuAuAuAucAGccGGTsT 976 CCGGCUGAuAuAuAuAUUCTsT 977 AD-14282 45% 6% uGucAucccuAuAGuucAcTsT 978 GUGAACuAuAGGGAUGAcATsT 979 AD-14283 35% 5% GAucuGGcAAccAuAuuucTsT 980 GAAAuAUGGUUGCcAGAUCTsT 981 AD-14284 58% 3% uGGcAAccAuAuuucuGGATsT 982 UCcAGAAAuAUGGUUGCcATsT 983 AD-14285 48% 3% GAuGuuuAccGAAGuGuuGTsT 984 cAAcACUUCGGuAAAcAUCTsT 985 AD-14286 49% 3% uuccuuAucGAGAAucuAATsT 986 UuAGAUUCUCGAuAAGGAATsT 987 AD-14287 6% 1% AGcuuAAuuGcuuucuGGATsT 988 UCcAGAAAGcAAUuAAGCUTsT 989 AD-14288 50% 2% uuGcuAuuAuGGGAGAccATsT 990 UGGUCUCCcAuAAuAGcAATsT 991 AD-14289 48% 1% GucAuGGcGucGcAGccAATsT 992 UUGGCUGCGACGCcAUGACTsT 993 AD-14290 112%? 7% uAAuuGcAcuAucuuuGcGTsT 994 CGcAAAGAuAGUGcAAUuATsT 995 AD-14291 77% 2% cuAucuuuGcGuAuGGccATsT 996 UGGCcAuACGcAAAGAuAGTsT 997 AD-14292 80% 6% ucccuAuAGuucAcuuuGuTsT 998 AcAAAGUGAACuAuAGGGATsT 999 AD-14293 58% 2% ucAAccuuuAAuucAcuuGTsT 1000 cAAGUGAAUuAAAGGUUGATsT 1001 AD-14294 77% 2% GGcAAccAuAuuucuGGAATsT 1002 UUCcAGAAAuAUGGUUGCCTsT 1003 AD-14295 62% 2% AuGuAcucAAGAcuGAucuTsT 1004 AGAUcAGUCUUGAGuAcAUTsT 1005 AD-14296 59% 4% GcAGAccAuuuAAuuuGGcTsT 1006 GCcAAAUuAAAUGGUCUGCTsT 1007 AD-14297 37% 1% ucuGAGAGAcuAcAGAuGuTsT 1008 AcAUCUGuAGUCUCUcAGATsT 1009 AD-14298 21% 1% uGcucAuAGAGcAAAGAAcTsT 1010 GUUCUUUGCUCuAUGAGcATsT 1011 AD-14299 ?6% 1% AcAuAAGAccuuAuuuGGuTsT 1012 ACcAAAuAAGGUCUuAUGUTsT 1013 AD-14300 17% 2% uuuGuGcuGAuucuGAuGGTsT 1014 CcAUcAGAAUcAGcAcAAATsT 1015 AD-14301 97% 6% ccAucAAcAcuGGuAAGAATsT 1016 UUCUuACcAGUGUUGAUGGTsT 1017 AD-14302 13% 1% AGAcAAuuccGGAuGuGGATsT 1018 UCcAcAUCCGGAAUUGUCUTsT 1019 AD-14303 13% 3% GAAcuuGAGccuuGuGuAuTsT 1020 AuAcAcAAGGCUcAAGUUCTsT 1021 AD-14304 38% 2% uAAuuuGGcAGAGcGGAAATsT 1022 UUUCCGCUCUGCcAAAUuATsT 1023 AD-14305 14% 2% uGGAuGAAGuuAuuAuGGGTsT 1024 CCcAuAAuAACUUcAUCcATsT 1025 AD-14306 22% 4% AucuAcAuGAAcuAcAAGATsT 1026 UCUUGuAGUUcAUGuAGAUTsT 1027 AD-14307 26% 6% GGuAuuuuuGAucuGGcAATsT 1028 UUGCcAGAUcAAAAAuACCTsT 1029 AD-14308 62% 8% cuAAuGAAGAGuAuAccuGTsT 1030 cAGGuAuACUCUUcAUuAGTsT 1031 AD-14309 52% 5% uuuGAGAAAcuuAcuGAuATsT 1032 uAUcAGuAAGUUUCUcAAATsT 1033 AD-14310 32% 3% cGAuAAGAuAGAAGAucAATsT 1034 UUCAUCUUCuAUCUuAUCGTsT 1035 AD-14311 23% 2% cuGGcAAccAuAuuucuGGTsT 1036 CcAGAAAuAUGGUUGCcAGTsT 1037 AD-14312 49% 6% uAGAuAccAuuAcuAcAGuTsT 1038 ACUGUAGuAAUGGuAUCuATsT 1039 AD-14313 69% 4% GuAuuAAAuuGGGuuucAuTsT 1040 AUGAAACCcAAUUuAAuACTsT 1041 AD-14314 52% 3% AAGAccuuAuuuGGuAAucTsT 1042 GAUuACcAAAuAAGGUCUUTsT 1043 AD-14315 66% 4% GcuGuuGAuAAGAGAGcucTsT 1044 GAGCUCUCUuAUcAAcAGCTsT 1045 AD-14316 19% 4% uAcucAuGuuucucAGAuuTsT 1046 AAUCUGAGAAAcAUGAGuATsT 1047 AD-14317 16% 5% cAGAuGGAcGuAAGGcAGcTsT 1048 GCUGCCUuACGUCcAUCUGTsT 1049 AD-14318 52% 11%? uAucccAAcAGGuAcGAcATsT 1050 UGUCGuACCUGUUGGGAuATsT 1051 AD-14319 28% 11%? cAuuGcuAuuAuGGGAGAcTsT 1052 GUCUCCcAuAAuAGcAAUGTsT 1053 AD-14320 52% 10%? cccucAGuAAAuccAuGGuTsT 1054 ACcAUGGAUUuACUGAGGGTsT 1055 AD-14321 53% 6% GGucAuuAcuGcccuuGuATsT 1056 uAcAAGGGcAGuAAUGACCTsT 1057 AD-14322 20% 2% AAccAcucAAAAAcAuuuGTsT 1058 cAAAUGUUUUUGAGUGGUUTsT 1059 AD-14323 116%? 6% uuuGcAAGuuAAuGAAucuTsT 1060 AGAUUcAUuAACUUGcAAATsT 1061 AD-14324 14% 2% uuAuuuucAGuAGucAGAATsT 1062 UUCUGACuACUGAAAAuAATsT 1063 AD-14325 50% 2% uuuucucGAuucAAAucuuTsT 1064 AAGAUUuGAAUCGAGAAAATsT 1065 AD-14326 47% 3% GuAcGAAAAGAAGuuAGuGTsT 1066 cACuAACUUCUUUUCGuACTsT 1067 AD-14327 18% 2% uuuAAAAcGAGAucuuGcuTsT 1068 AGcAAGAUCUCGUUUuAAATsT 1069 AD-14328 19% 1% GAAuuGAuuAAuGuAcucATsT 1070 UGAGuAcAUuAAUcAAUUCTsT 1071 AD-14329 94% 10%? GAuGGAcGuAAGGcAGcucTsT 1072 GAGCUGCCUuACGUCcAUCTsT 1073 AD-14330 60% 4% cAucuGAcuAAuGGcucuGTsT 1074 cAGAGCcAUuAGUcAGAUGTsT 1075 AD-14331 54% 7% GuGAuccuGuAcGAAAAGATsT 1076 UCUUUUCGuAcAGGAUcACTsT 1077 AD-14332 22% 4% AGcucuuAuuAAGGAGuAuTsT 1078 AuACUCCUuAAuAAGAGCUTsT 1079 AD-14333 70% 10%? GcucuuAuuAAGGAGuAuATsT 1080 uAuACUCCUuAAuAAGAGCTsT 1081 AD-14334 18% 3% ucuuAuuAAGGAGuAuAcGTsT 1082 CGuAuACUCCUuAAuAAGATsT 1083 AD-14335 38% 6% uAuuAAGGAGuAuAcGGAGTsT 1084 CUCCGuAuACUCCUuAAuATsT 1085 AD-14336 16% 3% cuGcAGcccGuGAGAAAAATsT 1086 UUUUUCUcACGGGCUGcAGTsT 1087 AD-14337 65% 4% ucAAGAcuGAucuucuAAGTsT 1088 CUuAGAAGAUcAGUCUUGATsT 1089 AD-14338 18% 0% cuucuAAGuucAcuGGAAATsT 1090 UUUCcAGUGAACUuAGAAGTsT 1091 AD-14339 20% 4% uGcAAGuuAAuGAAucuuuTsT 1092 AAAGAUUcAUuAACUUGcATsT 1093 AD-14340 24% 1% AAucuAAGGAuAuAGucAATsT 1094 UUGACuAuAUCCUuAGAUUTsT 1095 AD-14341 27% 3% AucucuGAAcAcAAGAAcATsT 1096 UGUUCUUGUGUUcAGAGAUTsT 1097 AD-14342 13% 1% uucuGAAcAGuGGGuAucuTsT 1098 AGAuACCcACUGUUcAGAATsT 1098 AD-14343 19% 1% AGuuAuuuAuAcccAucAATsT 1100 UUGAUGGGuAuAAAuAACUTsT 1101 AD-14344 23% 2% AuGcuAAAcuGuucAGAAATsT 1102 UUUCUGAAcAGUUuAGcAUTsT 1103 AD-14345 21% 4% cuAcAGAGcAcuuGGuuAcTsT 1104 GuAACcAAGUGCUCUGuAGTsT 1105 AD-14346 18% 2% uAuAuAucAGccGGGcGcGTsT 1106 CGCGCCCGGCUGAuAuAuATsT 1107 AD-14347 67% 2% AuGuAAAuAcGuAuuucuATsT 1108 uAGAAAuACGuAUUuAcAUTsT 1109 AD-14348 39% 3% uuuuucucGAuucAAAucuTsT 1110 AGAUUuGAAUCGAGAAAAATsT 1111 AD-14349 83% 6% AAucuuAAcccuuAGGAcuTsT 1112 AGUCCuAAGGGUuAAGAUUTsT 1113 AD-14350 54% 2% ccuuAGGAcucuGGuAuuuTsT 1114 AAAuACcAGAGUCCuAAGGTsT 1115 AD-14351 57% 8% AAuAAAcuGcccucAGuAATsT 1116 UuACUGAGGGcAGUUuAUUTsT 1117 AD-14352 82% 3% GAuccuGuAcGAAAAGAAGTsT 1118 CUUCUUUUCGuAcAGGAUCTsT 1119 AD-14353 ?2% 1% AAuGuGAuccuGuAcGAAATsT 1120 UUUCGuAcAGGAUcAcAUUTsT 1121 AD-14354 18% 11%? GuGAAAAcAUUGGccGuucTsT 1122 GAACGGCcAAUGUUUUcACTsT 1123 AD-14355 ?2% 1% cuuGAGGAAAcucuGAGuATsT 1124 uACUcAGAGUUUCCUcAAGTsT 1125 AD-14356 ?8% 2% cGuuuAAAAcGAGAucuuGTsT 1126 cAAGAUCUCGUUUuAAACGTsT 1127 AD-14357 ?6% 3% uuAAAAcGAGAucuuGcuGTsT 1128 cAGcAAGAUCUCGUUUuAATsT 1129 AD-14358 98% 17%? AAAGAuGuAucuGGucuccTsT 1130 GGAGACcAGAuAcAUCUUUTsT 1131 AD-14359 10% 1% cAGAAAAuGuGucuAcucATsT 1132 UGAGuAGAcAcAUUUUCUGTsT 1133 AD-14360 ?6% 4% cAGGAAuuGAuuAAuGuAcTsT 1134 GuAcAUuAAUcAAUUCCUGTsT 1135 AD-14361 30% 5% AGucAAcuAAAGcAuAuuuTsT 1136 AAAuAUGCUUuAGUUGACUTsT 1137 AD-14362 20% 2% uGuGuAAcAAucuAcAuGATsT 1138 UcAUGuAGAUUGUuAcAcATsT 1139 AD-14363 60% 6% AuAccAuuuGuuccuuGGuTsT 1140 ACcAAGGAAcAAAUGGuAUTsT 1141 AD-14364 12% 9% GcAGAAAucuAAGGAuAuATsT 1142 uAuAUCCUuAGAUUUCUGCTsT 1143 AD-14365 ?5% 2% uGGcuucucAcAGGAAcucTsT 1144 GAGUUCCUGUGAGAAGCcATsT 1145 AD-14366 28% 5% GAGAuGuGAAucucuGAAcTsT 1146 GUUcAGAGAUUcAcAUCUCTsT 1147 AD-14367 42% 4% uGuAAGccAAuGuuGuGAGTsT 1148 CUcAcAAcAUUGGCUuAcATsT 1149 AD-14368 93% 12%? AGccAAuGuuGuGAGGcuuTsT 1150 AAGCCUcAcAAcAUUGGCUTsT 1151 AD-14369 65% 4% uuGuGAGGcuucAAGuucATsT 1152 UGAACUUGAAGCCUcAcAATsT 1153 AD-14370 ?5% 2% AGGcAGcucAuGAGAAAcATsT 1154 UGUUUCUcAUGAGCUGCCUTsT 1155 AD-14371 54% 5% AuAAAuuGAuAGcAcAAAATsT 1156 UUUUGUGCuAUcAAUUuAUTsT 1157 AD-14372 ?4% 1% AcAAAAucuAGAAcuuAAuTsT 1158 AUuAAGUUCuAGAUUUUGUTsT 1159 AD-14373 ?5% 1% GAuAucccAAcAGGuAcGATsT 1160 UCGuACCUGUUGGGAuAUCTsT 1161 AD-14374 92% 6% AAGuuAuuuAuAcccAucATsT 1162 UGAUGGGuAuAAAuAACUUTsT 1163 AD-14375 76% 4% uGuAAAuAcGuAuuucuAGTsT 1164 CuAGAAAuACGuAUUuAcATsT 1165 AD-14376 70% 5% ucuAGuuuucAuAuAAAGuTsT 1166 ACUUuAuAUGAAAACuAGATsT 1167 AD-14377 48% 4% AuAAAGuAGuucuuuuAuATsT 1168 uAuAAAAGAACuACUUuAUTsT 1169 AD-14378 48% 3% ccAuuuGuAGAGcuAcAAATsT 1170 UUUGuAGCUCuAcAAAUGGTsT 1171 AD-14379 44% 5% uAuuuucAGuAGucAGAAuTsT 1172 AUUCUGACuACUGAAAAuATsT 1173 AD-14380 35% 16%? AAAucuAAcccuAGuuGuATsT 1174 uAcAACuAGGGUuAGAUUUTsT 1175 AD-14381 44% 5% cuuuAGAGuAuAcAuuGcuTsT 1176 AGcAAUGuAuACUCuAAAGTsT 1177 AD-14382 28% 1% AucuGAcuAAuGGcucuGuTsT 1178 AcAGAGCcAUuAGUcAGAUTsT 1179 AD-14383 55% 11%? cAcAAuGAuuuAAGGAcuGTsT 1180 cAGUCCUuAAAUcAUUGUGTsT 1181 AD-14384 48% 9% ucuuuuucucGAuucAAAuTsT 1182 AUUuGAAUCGAGAAAAAGATsT 1183 AD-14385 36% 2% cuuuuucucGAuucAAAucTsT 1184 GAUUuGAAUCGAGAAAAAGTsT 1185 AD-14386 41% 7% AuuuucuGcucAcGAuGAGTsT 1186 CUcAUCGUGAGcAGAAAAUTsT 1187 AD-14387 38% 3% uuucuGcucAcGAuGAGuuTsT 1188 AACUcAUCGUGAGcAGAAATsT 1189 AD-14388 50% 4% AGAGcuAcAAAAccuAuccTsT 1190 GGAuAGGUUUUGuAGCUCUTsT 1191 AD-14389 98% 6% GAGccAAAGGuAcAccAcuTsT 1192 AGUGGUGuACCUUUGGCUCTsT 1193 AD-14390 43% 0% GccAAAGGuAcAccAcuAcTsT 1194 GuAGUGGUGuACCUUUGGCTsT 1195 AD-14391 48% 4% GAAcuGuAcucuucucAGcTsT 1196 GCUGAGAAGAGuAcAGUUCTsT 1197 AD-14392 44% 3% AGGuAAAuAucAccAAcAuTsT 1198 AUGUUGGUGAuAUUuACCUTsT 1199 AD-14393 37% 2% AGcuAcAAAAccuAuccuuTsT 1200 AAGGAuAGGUUUUGuAGCUTsT 1201 AD-14394 114%? 7% uGuGAAAGcAuuuAAuuccTsT 1202 GGAAUuAAAUGCUUUcAcATsT 1203 AD-14395 55% 4% GcccAcuuuAGAGuAuAcATsT 1204 UGuAuACUCuAAAGUGGGCTsT 1205 AD-14396 49% 5% uGuGccAcAcuccAAGAccTsT 1206 GGUCUUGGAGUGUGGcAcATsT 1207 AD-14397 71% 6% AAAcuAAAuuGAucucGuATsT 1208 uACGAGAUcAAUUuAGUUUTsT 1209 AD-14398 81% 7% uGAucucGuAGAAuuAucuTsT 1210 AGAuAAUUCuACGAGAUcATsT 1211 AD-14399 38% 4% GcGuGcAGucGGuccuccATsT 1212 UGGAGGACCGACUGcACGCTsT 1213 AD-14400 106%? 8% AAAGuuuAGAGAcAucuGATsT 1214 UcAGAUGUCUCuAAACUUUTsT 1215 AD-14401 47% 3% cAGAAGGAAuAuGuAcAAATsT 1216 UUUGuAcAuAUUCCUUCUGTsT 1217 AD-14402 31% 1% cGcccGAGAGuAccAGGGATsT 1218 UCCCUGGuACUCUCGGGCGTsT 1219 AD-14403 105%? 4% cGGAGGAGAuAGAAcGuuuTsT 1220 AAACGUUCuAUCUCCUCCGTsT 1221 AD-14404 ?3% 1% AGAuAGAAcGuuuAAAAcGTsT 1222 CGUUUuAAACGUUCuAUCUTsT 1223 AD-14405 15% 1% GGAAcAGGAAcuucAcAAcTsT 1224 GUuGuGAAGUUCCuGUUCCTsT 1225 AD-14406 44% 5% GuGAGccAAAGGuAcAccATsT 1226 UGGUGuACCUUUGGCUcACTsT 1227 AD-14407 41% 4% AuccucccuAGAcuucccuTsT 1228 AGGGAAGUCuAGGGAGGAUTsT 1229 AD-14408 104%? 3% cAcAcuccAAGAccuGuGcTsT 1230 GcAcAGGUCUUGGAGUGUGTsT 1231 AD-14409 67% 4% AcAGAAGGAAuAuGuAcAATsT 1232 UUGuAcAuAUUCCUUCUGUTsT 1233 AD-14410 22% 1% uuAGAGAcAUCUGAcuuuGTsT 1234 cAAAGUcAGAUGUCUCuAATsT 1235 AD-14411 29% 3% AAuuGAucucGuAGAAuuATsT 1236 uAAUUCuACGAGAUcAAUUTsT 1237 AD-14412 31% 4%

Patent 7718629 has been saved.
View workspace.

Welcome to Archpatent!

Want to be "in the know" about patents and patent searching?

Close this box to view patent #7718629